Mircute mirna isolation kit

Total RNA was extracted using the Trizol total RNA reagent (TIANGEN, China) and reverse-transcribed into cDNA using the FastKing RT Kit (TIANGEN, China). qRT-PCR was performed using the SuperReal PreMx Plus reagent (TIANGEN, China), with the following primers (GENERAL BIOL, China): HIPK3 (NM_031144.3; 137 bp), forward: 5′-TCACAGAGGCTTGGAGACTG-3′ and reverse: 5′-ACAACATGTGCGATGCCTAC-3′; beta-actin (NM_031787.2; 173 bp), forward: 5′-CACCATGTACCCAGGCATTG-3′ and reverse: 5′-CCTGCTTGCTGATCCACATC-3′. Reaction conditions were as follows: pre-denaturation at 95 °C for 15 min, followed by 40 cycles of denaturation at 95 °C for 10 s, and annealing and extension at 60°C for 32 s. Beta-actin served as an internal control. The miRcute miRNA Isolation Kit was used to extract miRNA and cDNA was generated with miRcute Plus miRNA First-Strand cDNA Kit (TIANGEN, China). qRT‐PCR was carried out using the miRcute Plus miRNA qPCR Kit (TIANGEN, China) using the following reaction conditions: pre-denaturation at 95°C for 15 min, followed by 45 cycles of denaturation at 94°C for 20 s, and annealing and extension at 60°C for 34 s. Data were normalized to U6 spliceosomal RNA. The upstream and downstream miR-21 and U6 primers were designed by RiboBio Corporation (China).

Venous blood was collected after fasting followed with centrifugation of 4000 rpm at room temperature. Afterward, enzyme-linked immunosorbent assay (ELISA) was performed to determine concentration of omentin-1 in human serum (Apotech, Inc.).
Quantification of gene expression in BPH tissues by quantitative real-time PCR.
Total RNA was extracted using an RNAsimple Total RNA Kit (TIANGEN Biotech) and miRcute miRNA Isolation Kit (TIANGEN Biotech) and reverse transcribed using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher). Quantitative RT-PCR was performed using SuperReal PreMix Plus (TIANGEN Biotech) and the following primers:
IL-8:
Fwd: CCAGGAAGAAACCACCGGA
Rev: GAAATCAGGAAGGCTGCCAAG
IL-18:
Fwd: AAAACCTGGAATCAGATTACTTTGG
Rev: TCCGGGGTGCATTATCTCTA
β-actin:
Fwd: TTCCTTCCTGGGCATGGAGTC
Rev: TCTTCATTGTGCTGGGTGCC
Specific gene expression was quantified using the 2-ΔΔCT method. Gene expression normalization was performed using β-actin as a reference gene.

Small RNAs were extracted using the miRcute miRNA Isolation Kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. The RNA concentration was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Small RNAs were used to synthesize complementary DNA (cDNA) by reverse transcription with a miRcute Plus miRNA First‐Strand cDNA Synthesis Kit (Tiangen Biotech Co., Ltd.) with a reaction system volume of 20 μl. The forward primer sequence was 5′‐TAGCTTATCAGACTGATGTTGA‐3′. The reaction conditions of reverse transcription were as follows: 42°C for 60 min and 95°C for 3 min. qRT‐PCR was performed using the SYBR^®miRcute Plus miRNA qPCR Detection Kit (Tiangen Biotech Co., Ltd.). The reaction conditions of PCR were as follows: 95°C predenaturation for 15 min, followed by 40 cycles of 94°C denaturation for 20 s, 58°C annealing for 30 s, and a 72°C extension for 10 s. OpticonMonitor3 software (CFX96; Bio‐Rad Laboratories, Hercules, CA) was applied to analyze miR‐21 expression in HMECs. U6 small nuclear RNA was used as an internal control. The results of the qRT‐PCR analysis were determined based on the threshold cycle (C_t), and the relative expression levels were calculated using the 2−ΔΔCt method after normalization to the expression of the internal control gene.

Approximately 20-200-nt small RNA samples were isolated using the miRcute miRNA isolation kit (Tiangen Bio.Tech. Co., Ltd. Product no: DP501), the cDNA synthesis was performed using a miRcute plus miRNA first-strand cDNA synthesis kit (Tiangen Bio.Tech. Co., Ltd. Product no: KP211), and the qPCR reactions used a miRcute plus miRNA qPCR detection kit (Tiangen Bio.Tech. Co., Ltd. Product no: FP411). Subsequently, real-time qPCR was performed using a standard protocol on a Roche LightCycler® 480 Instrument II. Briefly, after initial denaturation at 95°C for 30 s, amplification was conducted for 40 cycles with denaturation at 95°C for 10 s, primer annealing at 60°C for 10 s, and DNA extension at 72°C for 10 s. All samples were run in triplicate, and the amount of each miRNA relative to that of U6 RNA was calculated using the 2^-△△Ct method [31 (link)]. Primers are listed in S1 Table.

Total RNAs (<200 nt) were extracted with a miRcute miRNA Isolation Kit according to the manufacturer’s protocol (Tiangen Biotech, Beijing Co., Ltd). Total RNAs were then transcribed into cDNA with a miRcute miRNA First-Strand cDNA Synthesis Kit (Tiangen Biotech, Beijing Co., Ltd). Subsequent PCR reactions were assembled in a 20 µl system with a miRcute miRNA qPCR Detection Kit (Tiangen Biotech, Beijing Co., Ltd) with a miR-155 specific forward primer. The forward primers of miR-155 and hsa-U6 were purchased from Tiangen Biotech, and the reverse primer was provided in the miRcute miRNA qPCR Detection Kit (Tiangen Biotech, Beijing Co., Ltd). PCR amplification was conducted according to the conditions: 1 cycle of initial denaturation (95 °C for 2 min), 40 cycles of amplification (94 °C for 20 s and 60 °C for 34 s). Quantitative real-time PCR was performed on a thermal cycler from Bio-Rad Laboratories. Results were analyzed with ABI SDS version 2.3. The relative expression level of miR-155 was calculated using the 2^−∆∆Ct method. Briefly, the cycle threshold (Ct) values were initially normalized to hsa-U6 in the same sample and designated as ∆Ct values. Subsequently, ∆∆Ct values were obtained by subtracting the ∆Ct values of the control samples from those of the treated samples.