Gtx213110 01

The following chemicals and reagents were procured from Sigma-Aldrich (St. Louis, MO, USA): AITC, methylene blue, propidium iodide (PI), ethanol, DMSO, and isopropanol. A concentration of 10 mM AITC was prepared by dissolving it in DMSO and storing it at 4 °C. RPMI 1640 and fetal bovine serum (FBS) were obtained from Biological Industries (Beit-Haemek, Israel), while RIPA buffer was purchased from Millipore (Burlington, MA, USA). The present study utilized primary antibodies against KDM8 (AVIVA SYSTEMS BIOLOGY; ARP58120_P050), H3K36me2 (GeneTex; GTX54108), Cyclin A1 (GeneTex; GTX02524), and GAPDH (GeneTex; GTX100118), as well as secondary antibodies (GeneTex; GTX213110-01, GTX213111-01).

The CRISPR/Cas9-mediated POLH-KO HEK293 cell line was generated as described previously [32 (link)]. The guide RNA (5′−CACCGGGATCGAGTGGTTGCTCTCG−3′) targeting the exon 1 was designed using the CRISPR design tool (http://crispr.mit.edu (accessed on 5 October 2018)). Cells were transduced with gRNA-encoding lentiviruses generated from LentiCRISPRV2 (Addgene #52961). Infected cells were selected using puromycin (2 μg mL⁻¹), and single cell clones were obtained through limited dilution in 96-well plates. The POLH knockout was confirmed by immunoblotting and genomic sequencing from candidate clones. Cell lysate preparation and immunoblotting was performed as described in [18 (link)], using anti-pol η (A301-231A, Bethyl Laboratories, Montgomery, TX, USA), anti-β-actin (GTX629630, Genetex, Irvine, CA, USA), anti-mouse IgG (GTX213111-01, Genetex), and anti-rabbit IgG (GTX213110-01, Genetex) antibodies.

The wells of transparent 96-well microtiter plates were coated with 100 μl of mouse anti-CTB (Abcam 35988, diluted 1: 1,000 in PBS) for 16 h at 4°C. The wells were then washed with 1 × PBST three times and blocked with blocking buffer (1% BSA in 1 × PBS) for 1.5 h. Soluble cytoplasmic fractions prepared as described above (100 μl) were added to each well and incubated for 2 h. The samples were removed, and the wells were washed three times; then, 100 μl of the primary antibody (rabbit anti-CTB, Abcam ab34992) 1/2,000 diluted in 1 × PBS were added. After 1 h of incubation, the primary antibody was removed, and the wells were washed three times. Then the secondary antibody (goat anti-rabbit IgG (HRP), GeneTex GTX213110-01) 1/5,000 diluted in 1 × PBS was added. The secondary antibody was removed, and the wells were washed three times, and then TMB solution was added. After adding the stop solution, we measured the samples using a plate reader (TECAN, Infinite 200 PRO) at O.D.₄₅₀.

The protein samples were gathered from the cells with an RIPA buffer (R0278, Merck/Millipore Sigma) or the fractionation step. Subsequently, the protein concentration was determined using a protein assay dye (5000006, BIO-RAD, Hercules, CA, USA) and access to an equal amount of protein, then separated by electrophoresis on SDS-PAGE. After the proteins were transferred on polyvinylidene difluoride (PVDF) membranes (1620177, BIO-RAD), the PVDF membrane was immersed in 5% skim milk at 1X TBST, blocking for 1 h at room temperature, and washed three times with 1X TBST for 5 min. Next, we incubated the PVDF membrane with the primary antibody at 4 °C overnight, washed it three times with 1X TBST for 5 min, and incubated it with the secondary antibody for 1 h at room temperature. It was washed three times with 1X TBST for 5 min after secondary antibody incubation, then we added the enhanced chemiluminescence (ECL) substrate kit (GERPN2134, Merck/Millipore Sigma) and detected the protein signal using an X-ray processor (MXP-101, KODAK, Rochester, NY, USA) on X-ray film (Super RX, FUJIFILM, Minato-ku, TKY, JPN). Primary and secondary antibodies were diluted with 5% skim milk in 1X TBST, and the detailed information isas follows: 1:2000 for uromodulin (sc-20631, Santa Cruz, Dallas, TX, USA) and 1:20,000 for rabbit HRP 2nd antibody (GTX213110-01, GeneTex, Irvine, CA, USA).

Western blot assay was performed as described previously³⁹ with the specific antibodies listed below: Anti‐Asialoglycoprotein Receptor 1 antibody (ASGR1‐Ab, ab254262, Abcam Inc., Cambridge, MA), Phospho‐Stat3 (Tyr705)(D3A7) XP Rabbit mab (pSTAT3 Ab, #9145, Cell Signaling Inc., Danvers, MA), Anti‐h/m/rSTAT3 purified mouse monoclonal IgG (STAT3 Ab, #MAB1799, R&D Systems Inc., Minneapolis, MN), GAPDH antibody (GTX100118, GeneTex Inc., CA), Mouse IgG antibody (HRP) (GTX213111‐01, GeneTex Inc., CA), Rabbit IgG antibody (HRP) (GTX213110‐01, GeneTex Inc., CA).

The brain samples were lysed in RIPA lysis buffer with protease inhibitor cocktail (B14001, Bimake) by a tissue homogenizer, followed by ultrasonication and centrifugation. The bicinchoninic acid method was used to determine the concentrations of proteins that were mixed with 5 × Laemmli sample buffer and denatured for 5 min at 95 °C. A total of 30 µg of each sample was separated by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto nitrocellulose membranes. The membranes were incubated with blocking buffer (TBST buffer containing 5% skim milk powder) for 60 min at room temperature. Next, the membranes were incubated overnight at 4 °C with the primary antibodies. The primary antibodies were as follows: anti-FTO (1:1000, ab92821, Abcam), anti-ADRB2 (1:1000, ab182136, Abcam), anti-SIRT1 (1:1000, 8469 S, Cell Signaling Technology), anti-c-MYC (9402 S, 1:1000, Cell Signaling Technology), and anti-GAPDH (1:10000, GTX100118, GeneTex), HRP-conjugated secondary anti-rabbit (1:5000, GTX213110-01, GeneTex), and HRP-conjugated secondary anti-mouse (1:5000, GTX213111-01, GeneTex). After incubation for 1 h with the corresponding secondary antibodies, the protein bands were detected by chemiluminescence using an ECL reagent.