Dna safe stain
DNA-safe stain is a laboratory reagent used to visualize nucleic acids, such as DNA, in gel electrophoresis. It is designed to safely and effectively stain DNA without compromising its integrity.
Lab products found in correlation
15 protocols using dna safe stain
Molecular Detection of Head Lice
Typing agr Genes in Bacterial Isolates
Screening of Acinetobacter baumannii Efflux Pumps
Primers used for detection of efflux pump genes
Target | 5′–3′ |
---|---|
adeF | Forward: GGTGTCGACCAAGATAAACG |
Reverse: GTGAATTTGGCATAGGGACG | |
adeJ | Forward: GCGAATGGACGTATGGTTCT |
Reverse: CATTGCTTTCATGGCATCAC | |
16S ribosomal RNA | Forward: AACGGACGACCATCTTTGAGTATT |
Reverse: CAGTTGTTCCATTTCACGCATT |
LAMP-based Detection of Toxocara spp.
Virulence Gene Detection in Bacteria
The electrophorese of PCR products was done by 1–1.5% agarose gel; then, they were visualized by the use of DNA SafeStain (SinaClon, Tehran, Iran), and in the next stage, they were photographed under UV light. Positive control isolates were generously provided.
Molecular Detection of Foodborne Pathogens
Biofilm and Antibiotic Resistance Gene Detection
Molecular Confirmation of R. equi Presence
Detecting Toxoplasma gondii in Fecal Samples
PCR was conducted at a final volume of 25 μl including 0.5 μl of 10 mM of each deoxynucleoside triphosphate (dNTPs), 3 μl of 10× PCR buffer without MgCl2, 2.5 mmol/l MgCl2, 1 unit of Taq polymerase (Cinnagene, Iran), 0.5 μM of each primer (10 mM), 3 μl of template DNA, and 7.5 μL of sterile distilled water. Amplification reactions were performed under the following condition: one cycle at 95 °C for 4 min, followed by 36 cycles at 94 °C for 45 s, annealing at 56 °C for 45 s, and preservation at 72 °C for 1 min with the final extension step at 72 °C for 10 min following the last cycle. PCR products were screened on a 1–1.5% agarose gel, visualized by DNA safe stain (SinaClon Co., Iran), and photographed under UV light. Moreover, PCR-amplified products were confirmed by sequencing analysis (Macrogen Korea), and the obtained sequence results were examined by using the NCBI BLAST program (Primer blast).
MRSE and MRSH Genomic DNA Extraction
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!