Antisense morpholino

Manufactured by Gene Tools

Sourced in United States

Antisense morpholinos are synthetic oligonucleotides designed to modify gene expression. They function by binding to and blocking the translation or splicing of target mRNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Endo porter, by Gene Tools (1 mentions) Im 300 microinjector, by Narishige (1 mentions) Femtojet micromanipulator 5171, by Eppendorf (1 mentions) Standard morpholino, by Gene Tools (1 mentions)

Close spelling variants of this product

Morpholinos (190 citations) Morpholino antisense oligonucleotides (102 citations) Antisense morpholino oligonucleotides (MOs) (19 citations) Morpholino antisense oligonucleotides (MOs) (12 citations) Antisense morpholinos (MOs; (11 citations) Morpholino antisense oligos (MO) (10 citations) Morpholino antisense oligos (10 citations) Morpholino-modified antisense oligonucleotides (MOs) (6 citations) Morpholino-modified antisense oligonucleotides (4 citations) Morpholino antisense oligomers (MOs; (4 citations)

13 protocols using antisense morpholino

Xp54 mRNA Antisense Morpholino Downregulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antisense morpholinos (Gene Tools, Philomath, OR) were directed against RNA sequences adjacent to translation start site (bold, where included):
Xp54 mRNA 3'TACTCGTGGCGGTCTTGTCTCTTGG 5'
All injected Antisense morpholinos showed specific down-regulation of both endogenous and recombinant forms of the target proteins. No deleterious effect on oocytes were observed.

Ladomery M, & Sommerville J. (2015). The Scd6/Lsm14 protein xRAPB has properties different from RAP55 in selecting mRNA for early translation or intracellular distribution in Xenopus oocytes. Biochimica et biophysica acta, 1849(11).

+ Open protocol

+ Expand

Morpholino Knockdown of Na,K-ATPase α1a.1 in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of four α1-like and two β subunit Na,K-ATPase genes have been identified in the inner ear with distinct spatiotemporal patterns of expression (Blasiole et al., 2003 (link)). Antisense morpholino (Gene Tools LLC; Philomath, OR) with sequence (5’-gccttctcctcgtcccattttgctg-3’) targeted against the Na,K-ATPase α-subunit gene atp1a1a.1 (α1a.1) was developed to knockdown expression in the early otic vesicle (Blasiole et al., 2006 (link)). The ability of the morpholino to act specifically to knockdown translation of only the relevant isoform of the Na,K-ATPase mRNA was previously demonstrated using an in vitro translation assay (Blasiole et al., 2006 (link)). To examine the role of the Na,K-ATPase in controlling ear growth, the morpholino was injected into 1 cell wild-type zebrafish embryos. Here, we report our results from using two different doses consisting of 0.25 ng in Figure 5D. In comparison to wild-type phenotypes, 0.5 ng morphants developed smaller otic vesicles, displayed smaller or absent otoliths, curved tails, and lagged in overall development (data not shown). Higher doses of morpholino injection (>1 ng) made embryos unhealthy prior to otic vesicle lumenization.

Mosaliganti K.R., Swinburne I.A., Chan C.U., Obholzer N.D., Green A.A., Tanksale S., Mahadevan L, & Megason S.G. (2019). Size control of the inner ear via hydraulic feedback. eLife, 8, e39596.

+ Open protocol

+ Expand

Orc2 mRNA Knockdown in Mouse Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

An antisense morpholino was purchased from GeneTools (Philomath, OR, USA) targeting the major Orc2-mRNA transcripts (a and b) with the sequence 5′-TTTCCTTTAACTGCAGAGTGCT-3′ which included a 3′ fluorescein. The control morpholino 5′-CCTCTTACCTCAGTTACAATTTATA-3′ also had a 3′ fluorescein. The negative control morpholino targets a human beta-globin intron mutation that should have little impact on phenotype. To determine the optimal amount of morpholino for microinjection into the mouse embryo, embryos were injected with increasing concentrations (0.2 mM, 5.0 mM and 10 mM) of the control morpholino, and their development was followed. Since injection of 0.2 mM control morpholino resulted in no obvious complications to the embryo, this concentration was used for testing the Orc2-mRNA targeting morpholino. For preparation, morpholinos were resuspended in PCR grade water and heated for 15 min at 65°C prior to injection. M-II embryos were injected with either the Orc2-mRNA targeting or control morpholino and permitted to rest for 1 h prior to ICSI.

Ortega M.A., Ko M., Marh J., Finberg A., Oshiro M, & Ward W.S. (2016). Presence of the Paternal Pronucleus Assists Embryo in Overcoming Cycloheximide Induced Abnormalities in Zygotic Mitosis. Journal of cellular biochemistry, 117(8), 1806-1812.

+ Open protocol

+ Expand

Knockdown of ZNF281 and DNMT3B via Morpholinos

Check if the same lab product or an alternative is used in the 5 most similar protocols

JTE-607 was purchased from MedChemExpress (Cat# HY-110133). The antisense morpholino was purchased from Gene Tools. The antisense oligonucleotide sequences employed in this study are provided below: NC-morpholino: 5’-CCTCTTACCTCAGTTACAATTTATA-3’; ZNF281- morpholino: 5’-AATTTTGGATCAGCCCAGATGGAGA-3’; DNMT3B- morpholino: 5’-GGCTCCAGTTACAAAAAAAATTTTA-3’. Hsa-miR-590-3p antagomir was purchased from Ribobio (Cat# miR30004801-4-5).

Lin P., Chen W., Long Z., Yu J., Yang J., Xia Z., Wu Q., Min X., Tang J., Cui Y., Liu F., Wang C., Zheng J., Li W., Rich J.N., Li L, & Xie Q. (2024). RBBP6 maintains glioblastoma stem cells through CPSF3-dependent alternative polyadenylation. Cell Discovery, 10, 32.

+ Open protocol

+ Expand

Morpholino Knockdown of miR-128

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antisense morpholino were synthesized by Gene Tools. Morpholino solution was injected into single-cell embryos at a final concentration of 0.75 ng μl⁻¹: control morpholino (5′-CCTCTTACCTCAGTTACAATTTATA-3′), mixture of miR-128-1 (5′-ACCGGTTCACTGTGAGAAAGCCTAC-3′) and miR-128-2 (5′-ACCGGTTCACTGTGAGACGAGT-3′).

Ghersi J.J., Baldissera G., Hintzen J., Luff S.A., Cheng S., Xia I.F., Sturgeon C.M, & Nicoli S. (2023). Haematopoietic stem and progenitor cell heterogeneity is inherited from the embryonic endothelium. Nature Cell Biology, 25(8), 1135-1145.

+ Open protocol

+ Expand

Antisense Morpholino Modulation of miR-93/25

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antisense morpholino (Gene Tools) against the 3′SS between miR-93 and miR-25, 5′ TCCTGTGAGGGAGACCAGACCCTTT 3′, was transfected to HeLa cells with endo-porter (Gene Tools). One milliliter of medium without serum was added to 3.5-cm plates. Morpholino was added to a concentration of 10 µM followed by the addition of endo-porter, final concentration 0.6%. RNA was extracted 24 h later. The results represent two biological repeats and at least three repeats of each.

Agranat-Tamir L., Shomron N., Sperling J, & Sperling R. (2014). Interplay between pre-mRNA splicing and microRNA biogenesis within the supraspliceosome. Nucleic Acids Research, 42(7), 4640-4651.

+ Open protocol

+ Expand

Knockdown of p53 and Irf7 in Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antisense morpholinos were ordered from Gene Tools including p53 MO and irf7 MO. The p53 MO: 5′-GCGCCATTGCTTTGCAAGAATTG-3′ was injected at the dose of 4 ng per embryo and the irf7 MO was conducted as previously described [26 (link)].

Lu X., Wei Y, & Liu F. (2015). Direct regulation of p53 by miR-142a-3p mediates the survival of hematopoietic stem and progenitor cells in zebrafish. Cell Discovery, 1, 15027-.

+ Open protocol

+ Expand

Downregulation of Zebrafish ak2 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antisense morpholinos targeting the ak2 ATG region (ak2 MO1, 5′-CATGGCTACAGCTTCTTTACTAACT-3′) or the splice acceptor site of ak2 intron 3 (ak2 MO2; Pannicke et al., 2009 (link)) and the standard control MO (ST-CTRL MO, 5′-CCTCTTACCTCAGTTACAATTTATA-3′) were manufactured by Gene Tools. The morpholinos were used according to the manufacturer’s instructions, and the indicated amount of each morpholino was injected into the yolk of one-cell-stage WT embryos. To confirm that AK2 pre-mRNA was specifically targeted, RT-PCR was performed on ak2 MO2-injected embryos. RT-PCR on ST-CTRL MO–injected embryos was included as a control.

Rissone A., Weinacht K.G., la Marca G., Bishop K., Giocaliere E., Jagadeesh J., Felgentreff K., Dobbs K., Al-Herz W., Jones M., Chandrasekharappa S., Kirby M., Wincovitch S., Simon K.L., Itan Y., DeVine A., Schlaeger T., Schambach A., Sood R., Notarangelo L.D, & Candotti F. (2015). Reticular dysgenesis–associated AK2 protects hematopoietic stem and progenitor cell development from oxidative stress. The Journal of Experimental Medicine, 212(8), 1185-1202.

+ Open protocol

+ Expand

Pou3f2 Knockdown in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pou3f2 KD in zebrafish was achieved using two different antisense morpholinos (Gene Tools, Oregon) targeting the Pou3f2 mRNA AUG translational start site with sequence: (Mo1) 5’-ATGATTGGATGCTGTAGTCGCCATG-3’, and (Mo2) 5’-CGGACTGATCGCTCCTATTAAAGGA-3’. As one control we used a 5-base pair mismatch MO: sequence 5’-ATcATTcGATcCTGTAcTCcCCATG-3’. To decipher the roles of Pou3f2 transcription factor in specific stages of endothelial development, we used Pou3f2-targeted caged morpholino (cMOs) (Shestopalov et al., 2007 (link)). This chemically modified morpholino allowed temporal gene silencing by using targeted UV illumination. An optimized dose of 0.5 ng/eggs (0.5 nL bolus) of Pou3f2 targeted morpholino was injected in each embryo at 1–2 cell stage, just below the cell mass.

Wong W.T., Matrone G., Tian X., Tomoiaga S.A., Au K.F., Meng S., Yamazoe S., Sieveking D., Chen K., Burns D.M., Chen J.K., Blau H.M, & Cooke J.P. (2017). Discovery of novel determinants of endothelial lineage using chimeric heterokaryons. eLife, 6, e23588.

+ Open protocol

+ Expand

Suppression of Cdk9 and Larp7 with Morpholinos

Check if the same lab product or an alternative is used in the 5 most similar protocols

Suppression of Cdk9 and Larp7 expression was achieved using antisense morpholinos (Gene Tools) designed against the splice donor between exon 3 and intron 3, or targeting the mRNA AUG translational start site.
Morpholino sequences were as follows: Cdk9-Mo-SB (accession number NM_212591.1) 5′-CTTTCTTCCCCATTCTTTTACGTGG-3′; Cdk9-Mo-TB 5′-CCTACGTCGCGCTGTTTTGGCCTTC-3′; Cdk9 control mismatch 5′-CTTTgTTgCCgATTgTTTTACcTGG-3′; Larp7-Mo-SB (accession number NM_199930.1) 5′-TCATCTCCATACTAAACCAAACTGT-3′; LARP7-Mo-TB 5′-TACTTTCACACAGTTGCGTTCTGCT-3′); Larp7 control mismatch 5′-TgATgTCCATAgTAAACgAAACTcT-3′. All mismatch morpholinos represent protein-specific oligonucleotides where mentioned in the text and figure legends.
0.5 nl of morpholino solution (100 µmol/l for Cdk9 and 200 µmol/l for Larp7) was injected in one- to two-cell-stage larvae, just beneath the blastoderm using a pulled glass pipette using a standard injector (IM300 Microinjector, Narishige, Japan). Successful injection was assessed under a fluorescence microscope by using the red tag lissamine at the 3′ end of the morpholino oligonucleotides.

Matrone G., Wilson K.S., Maqsood S., Mullins J.J., Tucker C.S, & Denvir M.A. (2015). CDK9 and its repressor LARP7 modulate cardiomyocyte proliferation and response to injury in the zebrafish heart. Journal of Cell Science, 128(24), 4560-4571.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!