Log In Sign up
The largest database of trusted experimental protocols

Gotaq 1 step rt qpcr kit

Manufactured by Promega
Visit Supplier
Sourced in United States

The GoTaq 1-Step RT-qPCR kit is a ready-to-use reagent system for the detection and quantification of RNA targets through reverse transcription and real-time quantitative PCR in a single reaction. The kit includes all the necessary components to perform both the reverse transcription and real-time PCR steps.

Automatically generated - may contain errors

Lab products found in correlation

Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (2 mentions) Nucleospin 96 rna kit, by Macherey-Nagel (2 mentions) Kod hot start dna polymerase, by Merck Group (2 mentions) Kod hot start dna polymerase, by Agilent Technologies (2 mentions) Quikchange method, by Agilent Technologies (2 mentions) Pgex 6p 1 vector, by GE Healthcare (2 mentions) Qiacube ht robot, by Qiagen (1 mentions) Qiaamp 96 dna kit, by Qiagen (1 mentions) Quantstudio 12k flex real time pcr system, by Thermo Fisher Scientific (1 mentions) Nucleospin mini kit, by Macherey-Nagel (1 mentions) Mg132, by Merck Group (1 mentions) Rotor gene 6000, by Qiagen (1 mentions) Mxpro analysis software, by Agilent Technologies (1 mentions) Qiaamp viral rna mini kit, by Qiagen (1 mentions) Rotor gene q series software, by Qiagen (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Rotor gene q thermocycler, by Qiagen (1 mentions) Mx 3005, by Agilent Technologies (1 mentions) High pure viral rna kit, by Roche (1 mentions) Reliaprep rna tissue miniprep system, by Promega (1 mentions)

Close spelling variants of this product

GoTaq 1-Step RT-qPCR System kit GoTaq® Probe 1-Step RT-qPCR System Kit GoTaq Probe 1-Step RT-qPCR kit GoTaq® Probe 1-Step RT-qPCR System Protocol kit GoTaq 1-Step RT-qPCR GoTaq qPCR kit RT-qPCR kit RT kits

15 protocols using gotaq 1 step rt qpcr kit

1

SARS-CoV-2 Detection by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Experiments were carried out in duplicates
with a final volume of 10 μL per reaction using two of the assays
recommended by the CDC, the N assay (N1 primer mix) and the RNase
P assay, with the GoTaq 1-Step RT-qPCR kit (Promega). Each mix contained
the following: 10 μL of 2× GoTaq qPCR master mix, 0.4 μL
of 50× GoScript RT mix for 1-Step RT-qPCR, 1.2 μL of 16.6×
N1/RNase P assay primer mix by the CDC [Forward Primer (20 μM),
Reverse Primer (20 μM), Probe (5 μM)], 4 μL of extracted
RNA, and enough nuclease-free water (GoTaq 1-Step RT-qPCR kit, Promega)
to bring the volume to 20 μL. Reactions were performed following
the recommendations of the manufacturer: 15 min at 63 °C for
cDNA conversion, 2 min at 95 °C for AMV deactivation, and 45
cycles at 95 °C for 15 s and 55 °C for 45 s. Reactions were
plated in 96-well plates and loaded into a LightCycler 96 real-time
PCR system (LC96) (Roche Diagnostics). The N1 assay and the RNase
P assay were purchased from IDT and used following the recommendations
of the manufacturer.
Rodriguez-Manzano J., Malpartida-Cardenas K., Moser N., Pennisi I., Cavuto M., Miglietta L., Moniri A., Penn R., Satta G., Randell P., Davies F., Bolt F., Barclay W., Holmes A, & Georgiou P. (2021). Handheld Point-of-Care System for Rapid Detection of SARS-CoV-2 Extracted RNA in under 20 min. ACS Central Science, 7(2), 307-317.
+ Open protocol
+ Expand
2

SARS-CoV-2 Viral RNA Quantification by RT-qPCR

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantification of the viral genome by real-time RT-qPCR as previously described30 (link).

Nucleic acid from 100 μL of cell supernatant were extracted using QIAamp 96 DNA kit and Qiacube HT robot (both from Qiagen).

Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate T7-generated synthetic RNA standard. RT-qPCR reactions were performed on QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems) and analyzed using QuantStudio 12K Flex Applied Biosystems software v1.2.3. Primers and probe sequences, which target SARS-CoV-2 N gene, were: Fw: 5′-GGCCGCAAATTGCACAAT-3′ ; Rev : 5’-CCAATGCGCGACATTCC-3’; Probe: 5’-FAM-CCCCCAGCGCTTCAGCGTTCT-BHQ1-3’.

Touret F., Giraud E., Bourret J., Donati F., Tran-Rajau J., Chiaravalli J., Lemoine F., Agou F., Simon-Lorière E., van der Werf S, & de Lamballerie X. (2023). Enhanced neutralization escape to therapeutic monoclonal antibodies by SARS-CoV-2 omicron sub-lineages. iScience, 26(4), 106413.
+ Open protocol
+ Expand
3

RNAi-mediated PEX1 knockdown in T. brucei

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNAit tool was used to design RNAi target against PEX1 coding sequence (CDS), the selected RNAi target has no significant similarity to other CDSs in T. brucei. PEX1 RNAi construct was stably transfected into bloodstream form trypanosomes and following clonal selection, the cells were seeded at a density of 0.5 million cells/ml and treated with DMSO as negative control (-Tet) or RNAi-induced with 2 µg/mL tetracycline (+Tet) in biological triplicates. The growth of the cells was monitored daily by cell counting using the Neubauer chamber over a period of 6 days, both in the presence (+Tet) and absence of inducer (-Tet i.e., equivalent DMSO). Cells were harvested on days 1 and 2, and RNA was isolated using NucleoSpin® Mini kit (Macherey Nagel). Quantitative Realtime PCR (qRT-PCR) was performed using GoTaq® 1-Step RT-qPCR kit (Promega) with primers specific for PEX1 (RE7039-RE7040) and Tubulin (control, RE7000-RE7001), respectively. qRT-PCR of the samples was performed using Rotor-Gene™ 6000 (Qiagen). The results were analyzed using double delta Ct method (Livak and Schmittgen, 2001 (link)) and graphically plotted using GraphPad Prism 10 software. To study the effect of proteasomal inhibition, cells were treated with 25 µM MG-132 (Sigma) for 6 h, along with tetracycline induction at 2 µg/mL.
Mahadevan L., Arya H., Droste A., Schliebs W., Erdmann R, & Kalel V.C. (2024). PEX1 is essential for glycosome biogenesis and trypanosomatid parasite survival. Frontiers in Cellular and Infection Microbiology, 14, 1274506.
+ Open protocol
+ Expand
4

Quantitative RT-PCR for ZIKV Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Infected cells were washed with PBS and intracellular RNA was extracted using the Nucleospin 96 RNA kit (Macherey-Nagel). One-step RT-qPCR was performed using the GoTaq 1-Step RT-qPCR kit (Promega) with the following protocol: 15 min at 37°C, 10 min at 95°C followed by 40 cycles consisting of 10 s at 95°C, 30 s at 60°C, and 30 sec at 72°C (QuantStudio 6 Flex real-time PCR system, Applied Biosystems). The melting curve was obtained to certify specific amplification. Genome equivalent concentration was assessed with the standard curve method using known concentrations of synthetic RNA fragments corresponding to the ZIKV NS5 coding region and was normalized to the GAPDH level.
The ZIKV NS5 primers used were 5′-AAGTACACATACCAAAACAAAGTG (forward) and 5′-TCCGCTCCCCCTTTGGTCTTG (reverse). The GAPDH primers used were 5′-GGAGCGAGATCCCTCCAAAAT (forward) and 5′-GGCTGTTGTCATACTTCTCATGG (reverse).
Zoladek J., Burlaud-Gaillard J., Chazal M., Desgraupes S., Jeannin P., Gessain A., Pardigon N., Hubert M., Roingeard P., Jouvenet N, & Afonso P.V. (2022). Human Claudin-Derived Peptides Block the Membrane Fusion Process of Zika Virus and Are Broad Flavivirus Inhibitors. Microbiology Spectrum, 10(5), e02989-22.
+ Open protocol
+ Expand
5

Quantification of Influenza Virus in Samples

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Virus titers in nasal swabs, BAL fluid, and lung accessory lobe were determined by plaque assay on MDCK cells as previously described (25 (link)). Viral RNA was extracted from BAL fluid and homogenized lung samples with QIAamp viral RNA mini kit (Qiagen) according to the manufacturer’s instructions. Samples were quantified by Reverse Transcription quantitative Polymerase Chain Reaction (RT-qPCR) (GoTaq 1-Step RT-qPCR kit, Promega) for the influenza A virus M gene using an MxPro 3500P instrument and MxPro analysis software (Agilent). Briefly, reverse transcription was performed at 37°C for 15 min followed by 10 min at 95°C; 2-step cycling was then performed with denaturation for 10 s at 95°C with annealing for 31 s at 60°C, extension at 72°C for 31 s and collection at 81°C for 31 s and this was repeated for 40 cycles. The results were expressed as the number of copies of RNA using a standard 10-fold dilution series of M gene standard RNA. For M vRNA analysis, the following primers were used: forward primer, 5’-AGA TGA GTC TTC TAA CCG AGG TCG-3’, two reverse primers, 5’-TGC AAA AAC ATC TTC AAG TCT CTG-3’ and 5’-TGC AAA GAC ATC TTC CAG TCT CTG-3’.
Schmidt A., Paudyal B., Villanueva-Hernández S., Mcnee A., Vatzia E., Carr B.V., Schmidt S., Mccarron A., Martini V., Schroedel S., Thirion C., Waters R., Salguero F.J., Gerner W., Tenbusch M, & Tchilian E. (2023). Effect of mucosal adjuvant IL-1β on heterotypic immunity in a pig influenza model. Frontiers in Immunology, 14, 1181716.
+ Open protocol
+ Expand
6

Quantifying PKR Expression in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from PRO1190, PRO1190-ctrl kd, and PRO1190-PKR kd cells with TRIzol reagent following the manufacturer's protocol (Invitrogen), and 1 ng of total RNA was assayed per reaction. The standard curve was generated from 10-fold serial dilutions of a PRO1190 PKR containing plasmid (described above in PRO1190 PKR sequence analysis, pEQ1334) diluted in 200 pg/µL salmon sperm DNA. All samples were amplified in triplicate using the GoTaq 1-step RT-qPCR kit following the manufacturer's protocol (Promega) using PKR specific primers (#1063: 5′-CACAGAATTGACGGAAAGAC; #1064: 5′-ATCCCAACAGCCATTGTAGT). RT-qPCR was performed on a Rotor-Gene Q thermocycler (Qiagen) with temperature holds at 37°C×15 min and 95°C×10 min followed by 40 cycles of 95°C×10 s, 60°C×30 s. Raw data was analyzed using the included Rotor-Gene Q series software using the automatic cycle threshold (Ct) setting for assigning baseline and threshold for Ct determination. Nonlinear regression analysis to determine PKR copy number in the experimental samples was performed in GraphPad Prism 6.
Brennan G., Kitzman J.O., Rothenburg S., Shendure J, & Geballe A.P. (2014). Adaptive Gene Amplification As an Intermediate Step in the Expansion of Virus Host Range. PLoS Pathogens, 10(3), e1004002.
+ Open protocol
+ Expand
7

Quantifying APOBEC3 and ADAR RNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from knockdown cells in 12-well plates using the RNeasy Mini kit according to the manufacturer’s instruction. RNA levels of APOBEC3B, APOBEC3D, and ADAR were analyzed by RT-qPCR using the GoTaq 1-Step RT-qPCR kit (Promega) according to the manufacturer’s instructions using primers at a final concentration of 250 nM and 30 ng of RNA. Annealing temperature was set at 60°C and reactions were carried out on an Agilent Mx3005. This experiment was performed with 3 biological replicates and 3 technical replicates (N = 3∗2).
Kurkowiak M., Fletcher S., Daniels A., Mozolewski P., Silvestris D.A., Król E., Marek-Trzonkowska N., Hupp T, & Tait-Burkard C. (2023). Differential RNA editing landscapes in host cell versus the SARS-CoV-2 genome. iScience, 26(11), 108031.
+ Open protocol
+ Expand
8

Cloning and Characterizing Mouse FBP1 Enzyme

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse Fbp1 (NCBI reference AJ132693.1) was amplified from IMAGE EST 5054854 using KOD Hot Start DNA Polymerase (Merck Millipore) and cloned into the BamHI NotI sites to produce pET28a 6HIS-FBP1 and pET15 6HIS-HRV3C-FBP1. Mutations were created following the QuikChange method (Agilent) but using KOD Hot Start DNA Polymerase. The phosphatase domain of mouse 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 (NCBI reference NM_008824.3) covering amino acids 251-440 was amplified from mouse liver RNA (Agilent #736009-41) using GoTaq 1-step RT-qPCR kit (Promega). The resulting PCR product was ligated into pGEX-6P-1 vector (GE Healthcare) as a Bamh1-Not1 fragment. Spinach chloroplast fructose-1,6-bisphosphatase 58-415 was cloned from a synthetic fragment (GeneArt Strings, based on Uniprot P22418) and ligated into a modified pET-15b plasmid as a Bamh1-Not1 fragment. The sequence of all constructs was verified by in-house sequencing using the BigDye® Terminator 3.1 kit on a 3500xL Genetic analyzer (ABI-Invitrogen).
Hunter R.W., Hughey C.C., Lantier L., Sundelin E.I., Peggie M., Zeqiraj E., Sicheri F., Jessen N., Wasserman D.H, & Sakamoto K. (2018). Metformin reduces liver glucose production by inhibition of fructose-1-6-bisphosphatase. Nature medicine, 24(9), 1395-1406.
+ Open protocol
+ Expand
9

SARS-CoV-2 N gene quantification by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
For quantification of viral RNA by RT-qPCR, total RNA was isolated using the High Pure Viral RNA kit (Roche) according to the manufacturer’s instructions. Viral RNA was quantified using GoTaq 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844 to 28864) and reverse (Ngene R ccagacattttgctctcaagc 28960 to 28981) primers. Copy numbers were calculated from a standard curve produced with serial 10-fold dilutions of SARS-CoV-2-RNA. The amplification program began with the RT step for 15 min at 50 °C, then the denaturation step for 10 min at 95 °C, and 10 s at 95 °C, 10 s at 60 °C, and 10 s at 72 °C (40 cycles). The melting curve was obtained by temperature increment 0.5 °C/s from 60 °C to 95 °C.
Beucher G., Blondot M.L., Celle A., Pied N., Recordon-Pinson P., Esteves P., Faure M., Métifiot M., Lacomme S., Dacheux D., Robinson D.R., Längst G., Beaufils F., Lafon M.E., Berger P., Landry M., Malvy D., Trian T., Andreola M.L, & Wodrich H. (2022). Bronchial epithelia from adults and children: SARS-CoV-2 spread via syncytia formation and type III interferon infectivity restriction. Proceedings of the National Academy of Sciences of the United States of America, 119(28), e2202370119.
+ Open protocol
+ Expand
10

Quantitative RT-PCR for ZIKV Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Infected cells were washed with PBS and intracellular RNA was extracted using the Nucleospin 96 RNA kit (Macherey-Nagel). One-step RT-qPCR was performed using the GoTaq 1-Step RT-qPCR kit (Promega) with the following protocol: 15 min at 37°C, 10 min at 95°C followed by 40 cycles consisting of 10 s at 95°C, 30 s at 60°C, and 30 sec at 72°C (QuantStudio 6 Flex real-time PCR system, Applied Biosystems). The melting curve was obtained to certify specific amplification. Genome equivalent concentration was assessed with the standard curve method using known concentrations of synthetic RNA fragments corresponding to the ZIKV NS5 coding region and was normalized to the GAPDH level.
The ZIKV NS5 primers used were 5′-AAGTACACATACCAAAACAAAGTG (forward) and 5′-TCCGCTCCCCCTTTGGTCTTG (reverse). The GAPDH primers used were 5′-GGAGCGAGATCCCTCCAAAAT (forward) and 5′-GGCTGTTGTCATACTTCTCATGG (reverse).
Zoladek J., Burlaud-Gaillard J., Chazal M., Desgraupes S., Jeannin P., Gessain A., Pardigon N., Hubert M., Roingeard P., Jouvenet N, & Afonso P.V. (2022). Human Claudin-Derived Peptides Block the Membrane Fusion Process of Zika Virus and Are Broad Flavivirus Inhibitors. Microbiology Spectrum, 10(5), e02989-22.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!