Mo huapp695swe

All animal protocols were approved by the Animal Care and Use Committee of the Shiga University of Medical Science (Ethical committee approval number: 2013-6-12H). AβPP/PS1 double transgenic mice expressing a chimeric mouse/human amyloid protein precursor (Mo/HuAPP695swe) and a mutant human presenilin 1 with deletion at exon 9 (PS1-dE9) were obtained from Jackson Laboratory (Bar Harbor, ME, USA). Heterozygous females were bred with wild-type (WT) males. The offspring were genotyped by polymerase chain reaction (PCR) using the APP primers forward-GACTGACCACTCGACCAGGTTCTG/reverse-CTTGTAAGTTGGATTCTCATATCCG, and the following two presenilin 1 sequences forward-CTCTTTGTGACTATGTGGACTGATGTCGG/reverse-GTGGATAACCCCTCCCCCAGCCTAGACC and forward- ATTAGAGAACGGCAGGAGCA/reverse-GCCATGAGGGCACTAATCAT.
Heterozygous (n = 26) and WT (n = 12) male mice were used for experiments. All mice were housed in a controlled environment (23°C, 12/12 h light/dark cycle, light period from 8 am to 8 pm) with ad libitum access to food and water. One hundred grams of standard chow contains 24.88% crude protein, 5.03% crude fat, 49.78% of nitrogen-free extract (NFE), and 343.90 kcal energy (CLEA, Japan). This diet also contained 0.064 mg/g vitamin E, equivalent to a daily intake of 0.192 mg.

AβPPswe/PS1dE9 double transgenic mice (AβPP/PS1), expressing a chimeric mouse/human amyloid protein precursor (Mo/HuAPP695swe) and a mutant human presenilin 1 with deletion at exon-9 (PS1-dE9), were obtained from Jackson Laboratory (Bar Harbor, ME, USA). Mice were maintained by breeding heterozygous females with wild-type (WT) males, and offspring were genotyped by polymerase chain reaction. Only heterozygous and WT male mice were used in this study. All mice were housed at 23°C under a 12-h/12-h light/dark cycle (lights on from 8:00–20:00) with ad libitum access to food and water. Experiments were conducted with approval of the Animal Care and Use Committee of Shiga University of Medical Science.