Bicinchoninic acid (BCA) protein assay and western blot analyses were performed as described (Jung et al, 2012 (link)) using monoclonal anti-V5 antibody (1:5,000, Life Technologies), polyclonal anti-MGL antibody (1:1,000) (Dinh et al, 2002 (link)) and anti-actin monoclonal antibody (1:1,000, Calbiochem, La Jolla, CA).
Monoclonal anti v5 antibody
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Monoclonal anti-V5 antibody is a laboratory tool used to detect and purify proteins tagged with the V5 epitope. It is a highly specific antibody that recognizes the 14-amino acid V5 peptide sequence, which can be fused to recombinant proteins to facilitate their identification and purification.
Automatically generated - may contain errors
Lab products found in correlation
Anti mouse igg a488, by Thermo Fisher Scientific (2 mentions)
Axioplan 2, by Olympus (1 mentions)
Anti mouse alexa fluor 488, by Thermo Fisher Scientific (1 mentions)
Mitotracker red, by Thermo Fisher Scientific (1 mentions)
Fitc conjugated anti mouse secondary antibody, by Merck Group (1 mentions)
Axioplan 2 fluorescence microscope, by Zeiss (1 mentions)
Dapi 4 6 diamidino 2 phenylindole, by Merck Group (1 mentions)
Anti flag antibody, by Merck Group (1 mentions)
Imagequant software, by GE Healthcare (1 mentions)
Biomax xar film, by Kodak (1 mentions)
Tnt quick coupled transcription translation system, by Promega (1 mentions)
Monoclonal anti β actin, by Merck Group (1 mentions)
Prl tk vector, by Promega (1 mentions)
Psv β galactosidase vector, by Promega (1 mentions)
Keratinocyte serum free medium, by Thermo Fisher Scientific (1 mentions)
Pmir report luciferase vector, by Thermo Fisher Scientific (1 mentions)
Oligofectamine, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Facscalibur flow cytometer, by BD (1 mentions)
19 protocols using monoclonal anti v5 antibody
1
Protein Quantification and Detection via BCA and Western Blot
2
Immunolocalization of MIP Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MIP was immunolocalized using its V5-tagged inducibly expressed version. Following an overnight induced overexpression triggered by the addition of 1 μg/ml of tetracycline to the medium, cells were incubated with MitoTracker Red for 20 min as previously described [47 (link)]. Subsequently, they were fixed with 4% (w/v) paraformaldehyde in phosphate buffered saline (PBS) and then permeabilized with 0.2% (v/v) Triton X-100 in PBS. Incubation with monoclonal anti-V5 antibody (Life Technologies) was performed for 1 hr in PBS mixed with 0.5% (w/v) gelatin in 1:1,000 dilution. The secondary antibody was anti-mouse Alexa Fluor 488 in 1:2,000 dilution (Life Technologies). DNA was stained with ProLong®Gold antifade reagent with 4',6-diamidine-2'-phenylindole dihydrochloride (DAPI) (Molecular Probes). The immunofluorescence assay was performed using a Zeiss microscope Axioplan 2, equipped with an Olympus DP73 digital camera.
3
Mitochondrial Localization of TbIF1 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T. brucei subcellular localization of the overexpressed TbIF1 V5-tagged protein was determined by an immunofluorescence assay that amplified the signal of a monoclonal anti-V5 antibody (Life Technologies) with a FITC-conjugated secondary anti-mouse antibody (Sigma). Co-localization was verified using Mitotracker RED (Invitrogen), a dye that stains mitochondria in live cells and is well-retained after fixation. DAPI (4,6-diamidino-2-phenylindole; Sigma) treatment was used to visualize nuclear and mitochondrial DNA. The images of the stained cells and their fluorescence were captured with a Zeiss Axioplan 2 fluorescence microscope.
4
Kinase Assay and Immunoprecipitation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro kinase assay, mammalian cell culture, transfection, immunoprecipitation, 32P orthophosphate metabolic labeling, as well as the antibodies used in this study were described previously (Cui et al., 2015 (link)). U2OS cells (RRID: CVCL_0042 ) were originally obtained from and authenticated by the American Type Culture Collection (ATCC, Manassas, VA). Rabbit anti-V5 polyclonal antibody (Millipore, Billerica, MA; AB3792; RRID: AB_91591 ) was used for immunoprecipitation. Monoclonal anti-V5 antibody (Life Technologies, Carlsbad, CA; R960-25; RRID: AB_2556564 ) and anti-FLAG antibody (Sigma, St. Louis, MO; F3165; RRID: AB_259529 ) were used for Western blotting.
5
DMP1 Protein-DNA Binding Assay
6
Prostate Epithelial Cell Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RWPE-1 prostate epithelial cells were purchased from ATCC via LGC Standards. PC-3 cells were kindly provided by Prof. Norman Maitland (University of York, UK; [16] ). CHO cells were originally obtained from ECACC.
The pMIR-REPORT Luciferase vector and pre-miR molecules were purchased from Ambion (Warrington, UK). The pRL-TK vector, pSV-β-galactosidase vector and dual-luciferase reporter assay system were from Promega (Southampton, UK). The pcDNA3 mammalian expression vector, Lipofectamine2000, Oligofectamine and keratinocyte serum-free medium (SFM) were from Invitrogen (Paisley, UK).
The following antibodies were used at the following dilutions: monoclonal anti-V5 antibody 1∶500 (Invitrogen), goat polyclonal anti-ECE-1 1:1000 (R&D Systems), rabbit polyclonal anti-Upf1 1:200 (Santa Cruz) and monoclonal anti-β-actin 1∶10,000 (Sigma).
The pMIR-REPORT Luciferase vector and pre-miR molecules were purchased from Ambion (Warrington, UK). The pRL-TK vector, pSV-β-galactosidase vector and dual-luciferase reporter assay system were from Promega (Southampton, UK). The pcDNA3 mammalian expression vector, Lipofectamine2000, Oligofectamine and keratinocyte serum-free medium (SFM) were from Invitrogen (Paisley, UK).
The following antibodies were used at the following dilutions: monoclonal anti-V5 antibody 1∶500 (Invitrogen), goat polyclonal anti-ECE-1 1:1000 (R&D Systems), rabbit polyclonal anti-Upf1 1:200 (Santa Cruz) and monoclonal anti-β-actin 1∶10,000 (Sigma).
7
Quantifying Viral Protein Binding on Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CHO-K1 cells were detached with 4 mM EDTA at 37 °C and harvested in PBS. Cells (3x105 per experimental point) were incubated for 30 min on ice with 250 nM of the indicated viral recombinant proteins. Cells were then extensively washed with FACS buffer (PBS, 0.01% sodium azide and 0.5% bovine serum albumin) and incubated for 30 min at 4 °C with monoclonal anti-V5 antibody (Invitrogen) diluted 1:500 followed by anti-mouse IgG-A488 (Molecular Probes) diluted 1:500 in PBS. Finally, cells were resuspended in 0.5 ml FACS buffer and analysed in a FACSCalibur flow cytometer (BD Sciences).
8
HIV-1 Vif and APOBEC3G Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The proviral DNA constructs of wild-type HIV-1 (HXB2N) and Vif mutant (HXB2NΔVif) as well as Vif-cMyc expression vectors were provided by Xiao-Fang Yu (Johns Hopkins University) [11 (link),16 (link)]. HXB2B3 contains three point mutations in the C-terminal region of Vif as previously described [42 (link)]. The three point mutations were first introduced into a Vif transfer vector, which contained the EcoRI- EcoRI DNA fragment of HXB2N, using the primer GATGGAACAAGCCCCAGGCGACCGCGGGCCACGCAGGGAGCCACACAATGA and QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies). The DNA fragment containing the three point mutations was then sub-cloned into the HXB2N construct to generate HXB2B3. Wild-type A3G and A3GD128K mutant plasmids were gifts from Yong-Hui Zheng (Michigan State University). The Vif-resistant A3G mutant, HA-A3G20K/RΔ2K (hereafter referred to as HAA3G22K), was previously described [28 (link)]. The monoclonal anti-V5 antibody was purchased from Invitrogen. The rabbit anti-Vif antibody, rabbit anti-A3G antibody [43 ] and HIV-1 p24 monoclonal antibody [44 (link)] were obtained from NIH-ARRRP.
9
Antibody Characterization for S. cerevisiae Proteome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S. cerevisiae strains used in this study are described in Table S1. Anti-HA monoclonal antibody (HA.11, raised in mouse) and anti-myc monoclonal antibody (9E10 c-myc, raised in mouse) were purchased from Covance. Anti-Kar2 and anti-Sec61 antibodies (rabbit) were provided by P. Walter (University of California, San Francisco, San Francisco, CA). Anti-Sis1 antiserum (rabbit) was a gift from D. Cyr (University of North Carolina, Chapel Hill, NC). Monoclonal antiproteasome 20S α (mouse) and polyclonal anti–histone H3 (rabbit) were purchased from Abcam. Monoclonal anti–3-phosphoglycerate kinase antibody (mouse) and monoclonal anti-V5 antibody (mouse) were purchased from Invitrogen, monoclonal anti-Ydj1 antibody (mouse) was from StressMarq, monoclonal anti-GFP antibody (mouse) was purchased from Roche, and monoclonal anti-FLAG (mouse) was purchased from Sigma-Aldrich. Secondary antibodies labeled with Alexa Fluor 488 (anti–mouse) or Alexa Fluor 596 (anti–rabbit) were purchased from Molecular Probes. Anti–rabbit IRDye 680 and anti–mouse IRDye 800 secondary antibodies were purchased from LI-COR Biosciences. Anti-Ubr1 antiserum was raised in rabbit against a recombinant protein containing the 100 N-terminal amino acids of Ubr1. Anti-San1 antiserum was raised in rabbit against a protein containing the 100 C-terminal amino acids of San1.
10
Western Blot Protein Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For SDS-PAGE analysis, cell extracts were loaded onto SDS-polyacrylamide gels, migrated, and transferred to a nitrocellulose membrane at 3 mA/cm2. After transfer, membranes were blocked overnight in blocking buffer (5% milk powder, 0.1% Tween 20 in Tris-buffered saline, pH 8.0). Polyclonal antibodies against VgrG1a were used at a dilution of 1:1000 (22 (link)). Monoclonal anti-V5 antibody (Invitrogen) was used at a dilution of 1:5000. Monoclonal antibodies were used against the β subunit of RNA polymerase (NeoClone) 1:1000. Antibodies against PhoE and SecA were kindly provided by Jan Tommassen (Utrecht University) and used at a dilution of 1:2000 and 1:1000, respectively. Secondary antibodies conjugated to horseradish peroxidase were used at a dilution of 1:5000. Western blots were developed using Super-Signal West Pico Chemiluminescent Substrate (Pierce) and visualized on a LAS3000 Fuji Imager.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!