Groups of C57BL/6J females were super-ovulated with a 5 IU dose of pregnant mares' serum gonadotropin (PMSG) (Sigma Aldrich) injected intraperitoneally (I/P) on day 1, followed at day 3 by a 5 IU dose of human chorionic gonadotropin (HCG) (Sigma Aldrich) I/P and mated with vasectomised males to provide MII eggs. The zygote groups were mated to proven C57BL/6J stud males immediately after hCG dosing and checked the following day for post coital plugs. Plugged females were pooled and used for zygote harvest. Both zygote and MII egg groups were sacrificed on day 4. Oviducts from the zygote and egg groups were harvested separately and suspended in M2 media (Sigma Aldrich). Dissected oviducts were placed into a pre-heated dish of synthetic Human Tubal Fluid (HTF) media (Irvine Scientific, CA, USA) with bovine serum albumin (BSA) (Sigma Aldrich). Cumulus masses were released into the HTF/BSA medium and transferred into a drop of hyaluronidase (Sigma Aldrich) following which, a wide bore pipette was used to strip the eggs and zygotes of their cumulus cells. These were in turn collected by mouth pipette and washed through sequential drops of M2 media (Sigma Aldrich).
M2 media
Manufactured by Merck Group
Sourced in United States, Germany
M2 media is a laboratory culture medium used for the growth and maintenance of a variety of cell types, including embryonic stem cells and other pluripotent stem cells. It provides the necessary nutrients and growth factors to support the proliferation and self-renewal of these cell lines.
Automatically generated - may contain errors
Lab products found in correlation
Hyaluronidase, by Merck Group (7 mentions)
Femtojet micromanipulator, by Eppendorf (4 mentions)
Human chorionic gonadotropin (hcg), by Merck Group (4 mentions)
Bovine serum albumin (bsa), by Merck Group (4 mentions)
70 μm filter, by BD (3 mentions)
Dumont no 5 forceps, by Merck Group (2 mentions)
Milrinone, by Merck Group (2 mentions)
M16 media, by Merck Group (2 mentions)
Trypsin, by Thermo Fisher Scientific (2 mentions)
Mineral oil, by Merck Group (2 mentions)
Ksom media, by Merck Group (2 mentions)
Hepes, by Thermo Fisher Scientific (1 mentions)
Cytochalasin b, by Merck Group (1 mentions)
α mem medium, by Thermo Fisher Scientific (1 mentions)
Mmessage mmachine t7 ultra transcription kit, by Thermo Fisher Scientific (1 mentions)
Mmessage mmachine t7 ultra kit, by Thermo Fisher Scientific (1 mentions)
Htf medium, by Merck Group (1 mentions)
Pasteur pipette, by Merck Group (1 mentions)
Embryomax, by Merck Group (1 mentions)
Wild type cd1 females, by Charles River Laboratories (1 mentions)
56 protocols using m2 media
1
Superovulation and Zygote Harvesting Protocol
2
Embryo Culturing with M2 and KSOM Media
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All embryo culturing was performed in microdrops on standard bacterial petri dishes (Nunc Roskilde, Denmark) under mineral oil. M2 media (Millipore) was used for room temperature operations whereas long-term culture was conducted in bicarbonate-buffered KSOM (Millipore) in a 37 °C incubator containing 5% CO2.
3
Generating Chimeric Mice via Blastocyst Injection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Superovulated FVB/J females at 4‐5 weeks of age were mated with FVB/J males overnight. The next morning, mating was confirmed by vaginal plug, and mated females (0.5 days postcoitum, dpc) were euthanized by cervical dislocation for collection of zygotes from oviduct. Zona pellucida was removed by brief digestion in hyaluronidase. Alternatively, 3.5 dpc females were euthanized and uterine horns were flushed with M2 media (Millipore, MR‐015‐D) for collection of morula. Zygote and morula were both collected in M2 and cultured in preequilibrated KSOM media bubbles (Millipore, MR‐106‐D) under mineral oil immersion (Sigma, M8410) at 37°C (5% CO2, humidified) until blastocyst injection.
For blastocyst injection, cultured cCICs were trypsinized and pelleted in growth media supplemented with 1× HEPES (Gibco, 15 630 080). Approximately 8 to 12 cells were injected into each blastocyst. Following injection, blastocysts were washed in M2 and allowed to recover in KSOM for 30 minutes before uterine transfer. Approximately 15 to 20 blastocysts were transferred into the uterus of 2.5 dpc pseudopregnant recipient B6/CBA females mated with vasectomized Swiss Webster males. Alternatively, 20 to 25 blastocysts were transferred into the uterus of 0.5 dpc pseudopregnant B6/CBA females. FVB/J background GFP+ESCs were used as chimera generation control.
For blastocyst injection, cultured cCICs were trypsinized and pelleted in growth media supplemented with 1× HEPES (Gibco, 15 630 080). Approximately 8 to 12 cells were injected into each blastocyst. Following injection, blastocysts were washed in M2 and allowed to recover in KSOM for 30 minutes before uterine transfer. Approximately 15 to 20 blastocysts were transferred into the uterus of 2.5 dpc pseudopregnant recipient B6/CBA females mated with vasectomized Swiss Webster males. Alternatively, 20 to 25 blastocysts were transferred into the uterus of 0.5 dpc pseudopregnant B6/CBA females. FVB/J background GFP+ESCs were used as chimera generation control.
4
Enucleation and ICSI in Mouse Oocytes
5
Oocyte Manipulation and IVF in Mice
6
Generation of OC-STAMP and MMP12 Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
OC-STAMP-/- and MMP12-/- knockout mice were produced by Beijing View Solid Biotechnology, China. Briefly, the pCAG-T7-SaCas9 plasmid linearized by AvrII restriction was used as an in vitro transcriptional template. After purification, saCas9 mRNA was transcribed with the mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (Life Technology). Target gRNA templates were amplified based on the gRNA scaffold using T7 promoter sequence-conjugated primers (S7 Table ) and then transcribed using a fast in vitro transcription T7 kit (cat. no. VK010, Beijing View Solid Biotechnology, China) and frozen at -80°C. Zygotes of C57BL/6 mice were injected with saCas9 mRNA and target gRNA in M2 media (Millipore) using a FemtoJet micromanipulator (Eppendorf, Germany). Following microinjection, zygotes were transferred to pseudo pregnant female mice. All mice were maintained in a specific pathogen-free facility. The tail-derived DNA from 2-week-old newborn mice was genotyped by sequencing the PCR products amplified by primers (S7 Table ). Mutant mice were mated with wild-type C57BL/6 mice to obtain heterozygous knockout mice.
7
Embryo Collection and Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Details of experimental scheme regarding embryo collection can be found in Supplementary Fig. 6 . Two-cell, 4-cell, 8-cell, and blastocyst stage embryos were collected from superovulated naïve Ahr+/+and Ahr−/− females that were mated at E-0.5 with males of the corresponding genotype and exposed to control oil vehicle or TCDD at 46-, 55-, 70-, and 97-h post-hCG time into M2 media (Millipore, Burlington, MA), respectively. Litter sizes and morphology of 2-cell embryos and blastocysts were observed using a binocular stereomicroscope (AmScope, Irvine, CA).
8
TALEN-mediated Hmox1 knockout rats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TALEN-mediated Hmox1 knockout rats were produced by Beijing View Solid Biotechnology, China. TALEN constructs in the TALEN-L and TALEN-R expression vectors were prepared with a HiSpeed plasmid midi kit (Qiagene), and the vectors were linearized with NotI. TALEN-L and TALEN-R mRNAs were transcribed in vitro using the MESSAGE mMACHINE® SP6 Kit (Invitrogen) with a T7 promoter. Zygotes of SD rats (n = 120) were injected with TALEN-L and TALEN-R mRNAs in M2 media (Millipore) using a FemtoJet micromanipulator (Eppendorf, Germany). After microinjection, the zygotes were transferred to pseudopregnant females. Tail-derived DNA from 2-week-old newborn rats was genotyped by sequencing PCR products amplified by the following primers: HO1-T4-sens (TTGACAGCTGGGCTGAAATGCAC) and Hmox1-T4-anti (TTCTGCGCAATCTTCTTCAGGAC). A 507 bp DNA fragment containing the TALEN target site was amplified, and the mutant Hmox1 alleles were confirmed by PCR sequencing to identify frameshift mutations. The mutant rats were mated with wild-type SD rats to obtain heterozygous Hmox1+/− rats (Figures 1(a) and 1(b) ).
9
Generating MYOC-transgenic Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MYOC-transgenic mice were produced by Beijing View Solid Biotechnology, China. The plasmid pCAG-MYOC was linearized by BstEII restriction enzyme (NEB) digestion, purified, and injected into zygotes of C57BL/6 mice in M2 media (Millipore) using a FemtoJet micromanipulator (Eppendorf, Germany). Microinjected zygotes were transferred into pseudo-pregnant female mice. All mice were maintained in a specific pathogen-free facility. Genotype identification was performed by PCR and sequencing from 2-week-old newborn mice (Table S5). Transgenic mice were mated with wild-type C57BL/6 mice to obtain heterozygous mice and colony expansion.
10
CRISPR-mediated FMR1NB Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR-mediated FMR1NB knockout mice were produced by Beijing View Solid Biotechnology, China. The linear plasmid pCAG-T7-Cas9 cut by the NotI restriction enzyme was used as the in vitro transcriptional template. After gel purification, Cas9 mRNA was transcribed with the mMESSAGE mMACHINE T7 Ultra Kit (Life Technologies). The FMR1NB-g1 and FMR1NB-g2 templates were amplified based on the gRNA scaffold using T7 promoter sequence-conjugated primers: T7-FMR1NB-g1-FP, T7-FMR1NB-g2-FP and gRNA-RP. FMR1NB-g1 and FMR1NB-g2 were transcribed with a fast-in vitro transcription T7 kit (cat. no. VK010, Beijing View Solid Biotechnology, China) and frozen at 80 °C. Zygotes of C57BL/6 mice (n = 90) were injected with Cas9 mRNA and FMR1NB-g1 and FMR1NB-g2 in M2 media (Millipore) using a FemtoJet micromanipulator (Eppendorf, Germany). After microinjection, zygotes were transferred to pseudopregnant females. All mice were maintained in a specific pathogen-free facility. Tail-derived DNA from 2-week-old newborn mice was genotyped by sequencing the PCR products amplified by the primers: FMR1NB-sens and FMR1NB-anti (Supplementary Fig. S1 and Table S6 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!