For the PCR-restriction fragment length polymorphism (PCR-RFLP) step to indicate C>A transversion polymorphism in exon 4 of the GSTO1 gene, we used the restricting enzyme of CaC8 I (New England BioLabs, USA). The PCR-RFLP mixture included 16 μL of distilled water, 0.7 μL of CaC8 I, three μL of 10X NEBuffer® (New England BioLabs, USA), and 10 μL of PCR products so that the final volume was around 30 μL. This mixture was stored at 37 °C for 1 hour for digestion. The digested products appeared in 3 different patterns: (I) wild-type (140AA) showing 254 fragments; (II) heterozygote (140AD), 68, 186, and 254 bp fragments; and (III) homozygote (140DD) demonstrating 68 and 186 bp fragments (Figure 1 ).
Cac8i
Manufactured by New England Biolabs
Sourced in United States
Cac8I is a type II restriction endonuclease that recognizes and cleaves the DNA sequence 5'-GCNGC-3'. It is a useful tool for DNA manipulation and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Clai restriction enzyme, by New England Biolabs (1 mentions)
Mastercycler gradient, by Eppendorf (1 mentions)
Hpych4iii, by New England Biolabs (1 mentions)
Hpy166ii, by New England Biolabs (1 mentions)
Cfx96 real time thermocycler, by Bio-Rad (1 mentions)
D100 screen tape, by Agilent Technologies (1 mentions)
Bsp1407i, by Thermo Fisher Scientific (1 mentions)
8 protocols using cac8i
1
Genotyping GSTO1 Exon 4 Polymorphism
2
Nucleosome Restriction Enzyme Digestion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleosome products were PAGE-purified after replication as described above. PAGE-purified replicated nucleosomes, control dsDNA, and end-positioned nucleosomes were incubated in the presence of an excess of Bss SI, Msl I, Cac8 I, or Cla I restriction enzyme (New England Biolabs) for 30 min at 20°C before or after gel purification. Labeled DNA templates were then analyzed by native PAGE.
3
Genotyping the ET-1 Gene G5665T Polymorphism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To genotype the G5665T (rs5370) polymorphism on the endothelin-1 (ET-1) gene, a revised version of a previously published PCR protocol35 (link) and an PCR-RFLP assay was employed. Primer pairs rs5370F: 5′-TCTTGCTTTATTAGGTCGGAGACC-3′ and rs5370R: 5′-TTTGAACGAGGACGCTGGTC-3′ was used to amplify a part of the gene, with PCR setup and amplification conditions as follows: 95 °C for 10 min, and 35 cycles of 95 °C for 1 min (denaturation), 61 °C for 1 min (annealing), 72 °C for 1 min and 30 s (extension) and 72 °C for 10 min (final extension). PCR products of 262 bp were digested with 2U Cac8I (New England Biolabs, Boston MA) restriction endonuclease (2 hour incubation) at 37 °C on an Eppendorf gradient Mastercycler. Digested products were examined on a 2% ethidium bromide stained agarose gels and size analysis carried out as described.47 All PCR genotyping and restriction digestion were conducted anonymously, with 50% of samples subjected to repeat PCR and genotyping for quality control purposes with 100% concordance.
4
Generation and Characterization of tfeb Mutants
5
Genotyping of FUN025 Allele by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All genotyping was carried out by polymerase chain reaction (PCR). For FUN025 genotyping, PCR primers, mTmem135 F1 (GGTTTTTGGCAGGTGTGTC) and mTmem135 R1 (TGTGTGCTTGGCAACTTCTC), were used for amplification of the wild-type (WT) allele and FUN025 allele (118 bp). Cac8I (NewEngland Biolabs) was used to digest the FUN025 allele specifically to generate two bands (80 bp and 38 bp).
6
PCR-RFLP Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All of the endonucleases used were purchased from Thermo Scientific (Carlo Erba reagents, Cornaredo, Italy) except for the enzyme Cac8I, which was purchased from New England Biolabs (Ipswich, MA, United States). Then, 10 μl of amplified obtained from the PCR reaction was used for enzymatic cutting. The digestion mix was prepared using 2 μl of specific digestion buffer and 1 U of the enzyme in a total volume of 20 μl. The reaction was carried out for 1 h in a thermostatic bath by varying the temperature depending on the enzyme used, as specified in Supplementary Table 1 .
The information about each polymorphism is obtainable from the NCBI database; db SNPs with the relative expected digestion fragments predicted by the REBsite software are described in detail in theSupplementary Material .
An example of genotyping, regarding DRD1-B (rs4532) polymorphism, is shown inFigure 2 .
The information about each polymorphism is obtainable from the NCBI database; db SNPs with the relative expected digestion fragments predicted by the REBsite software are described in detail in the
An example of genotyping, regarding DRD1-B (rs4532) polymorphism, is shown in
7
Quantitative LAMP Reaction Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MATLAB script processes a .txt file with temperature-time data generated from the TE Tech Controller and a TIF stack containing 2-channel images of the LAMP and melt curve from the LEICA microscope. Partitions are identified using a custom iterative thresholding algorithm and labels are propagated throughout the TIF stack using a custom labeling algorithm. Average well intensity is tracked over time to generate LAMP curves and plotted against temperature to generate the melt curves. Complete details of the script are in the Supplementary Materials and Methods , ‘MATLAB script.’
Bulk LAMP reactions were conducted in 10 μl volumes within a well plate on a CFX96 Real-time Thermocycler (Bio-Rad) at buffer conditions and temperatures matching the dLAMP reactions.
Enzymatic digestions of bulk LAMP products were conducted using CAC8I (#R0579S), Hpy166II (#R0616S), ACCI (#R0161S), AciI (#SR0551S), MseI (#R0525S) and HpyCH4III (#R0618S) purchased from New England Biolabs and were conducted in 50 μl reaction volumes containing 1 μl enzyme, 1 μg DNA, in 1 × Cut Smart Buffer and incubated for 1 h at 37°C. Samples were inactivated for 1 h at 80°C and diluted to 1 ng/μl (∼1:300) to run on an Agilent 4200 TapeStation using High Sensitivity D5000 ScreenTape (#5067-5592) with ladder (#5190-7747), and D100 ScreenTape (#5067-5584) with High Sensitivity D1000 Reagents (#5067-5585).
8
DNA Extraction and Genetic Mapping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extractions were conducted on leaves from seedlings as described by Loudet et al (2002) (link).
Markers for the fine-mapping are described in Figure 5 Source Data 1. For CAPS markers M3 and M12 we used Cac8I (NEB) and Bsp1407I (ThermoFisher) restriction enzymes, respectively. Other SNPs were genotyped by sequencing. For the fine-mapping of PK3, we genotyped a total of 4,717 plants and identified 42 recombinants between markers M1 and M15.
We selected 23 informative recombinants that were tested for segregation distortion at the locus by genotyping their self-descent progenies with appropriate markers (Figure 5 Source Data 1).
All the other primers used in this work for mutant characterization, gene expression, PCR amplification and DNA sequencing are listed in Supplemental File 1.
Markers for the fine-mapping are described in Figure 5 Source Data 1. For CAPS markers M3 and M12 we used Cac8I (NEB) and Bsp1407I (ThermoFisher) restriction enzymes, respectively. Other SNPs were genotyped by sequencing. For the fine-mapping of PK3, we genotyped a total of 4,717 plants and identified 42 recombinants between markers M1 and M15.
We selected 23 informative recombinants that were tested for segregation distortion at the locus by genotyping their self-descent progenies with appropriate markers (Figure 5 Source Data 1).
All the other primers used in this work for mutant characterization, gene expression, PCR amplification and DNA sequencing are listed in Supplemental File 1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!