Plasmids carrying Cas9 (pRGEN-CMV-Cas9-RFP-Puro, 3 μg) and sgRNA targeting the DNAJC6 gene region encompassing the intron 6–exon 7 junction (ACCTTCTGTTTCAGATACCT, pRGEN-U6-SGhDNAJC6, 3 μg) were introduced to hESCs (1 × 106 cells/100 μl) using a NEPA21 electroporator (NEPAGENE) following the manufacturer’s instruction. Transfected hESC colonies were identified by red fluorescence (RFP expression) and selected using puromycin treatment (50 mg/ml). The puromycin-selected colonies were picked, seeded into 96-well plates (1 cell per well), and expanded. The targeted region of DNAJC6 gene was amplified using touchdown PCR and subjected to T7E1 assay (NEB) to detect the gene-edited clones. The PCR-amplified fragments were cloned in a TA-cloning vector and subjected to Sanger sequencing to confirm the edited nucleotide sequence. To characterize hESC chromosomal integrity after editing using CRISPR-Cas9, hESCs were karyotyped using the standard protocol for high-resolution G-banding.
T7e1 assay
Manufactured by New England Biolabs
Sourced in United States
The T7E1 assay is a laboratory technique used to detect and analyze genetic mutations. It utilizes the T7 endonuclease I enzyme to identify and cleave DNA sequences containing mismatches or imperfections. The T7E1 assay provides a simple and efficient method for screening and detecting genetic variations without the need for extensive sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Nepa21 electroporator, by Nepa Gene (1 mentions)
Puregene core kit, by Qiagen (1 mentions)
Accutase, by Bio-Techne (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
Y 27632, by Bio-Techne (1 mentions)
Mtesr1, by Bio-Techne (1 mentions)
Peasy t vector, by Transgene (1 mentions)
Megascript t7 kit, by Thermo Fisher Scientific (1 mentions)
Megaclear kit, by Thermo Fisher Scientific (1 mentions)
Nucleospin tissue xs kit, by Macherey-Nagel (1 mentions)
Megascript t7 transcription kit, by Thermo Fisher Scientific (1 mentions)
Cas9 enzyme, by Integrated DNA Technologies (1 mentions)
Lipofectamine crisprmax, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Nucleospin tissue kit, by Macherey-Nagel (1 mentions)
Gotaq colorless master mix, by Promega (1 mentions)
12 protocols using t7e1 assay
1
CRISPR-Cas9 Editing of DNAJC6 in hESCs
2
Genomic DNA Isolation and Target Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Puregene Core Kit (158,445, Qiagen) was used to isolate genomic DNA from the cat ears. Genomic fragments containing C2-1 target regions were amplified from the genomic DNA by PCR using the optimized primers (Supplementary Table 5 ). The PCR products were visualized on a 2% agarose gel stained with SYBR nucleic acid gel stain and then applied to T7E1 assay (M0302L, New England Biolabs) where it was sequenced, cloned into the pcDNA3.1 cloning vector (V79020, Invitrogen, Waltham, MA, USA), and transformed into 5-alpha competent E. coli (C2987H, New England Biolabs). After spreading and overnight culture, 20 random colonies were collected and grown, and the plasmid DNA was isolated and sequenced. We confirmed the mutations by aligning the sequenced alleles with WT alleles.
3
Detecting CRISPR-Induced Mutations in Porcine Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ZFNs-induced fibroblast and oocyte mutations were detected using a T7E1 assay (New England BioLabs, USA) following the manufacturer’s protocol and a recently reported method (Kim et al., 2009 (link)). ZFNs-treated porcine genomic DNA was extracted from the following two samples: (1) fibroblasts that were transfect 2 days later, and (2) embryos that had developed to the blastula stage. PCR analysis of fibroblast genomic DNA was performed using the myostatin primers MSTN-1-F (5′-AAAGGAAGAAATAAGAACAAGGA-3′) and MSTN-1-R (5′-TTACACTCTGTAGGCATGGTAAT-3′) under the following conditions: 95°C for 4 min; 36 cycles of 94°C for 30 s, 58°C for 30 s, 72°C for 40 s; and a final extension at 72°C for 5 min. PCR analysis of embryonic DNA was performed in two steps. Step 1 employed myostatin primers MSTN-P1-F (5′-GTGGAG CAAGAGCCAATCATAGA-3′) and MSTN-P1-R (5′-CAGCAGCTTTCAGTCTCATTAGTTTAT-3′) under the following conditions: 95°C for 4 min; 36 cycles of 94°C for 30 s, 58°C for 30 s, 72°C for 50 s; and a final extension at 72°C for 7 min. In Step 2, the PCR amplicons from Step 1 were purified, then a nested PCR was performed using primers MSTN-1-F and MSTN-1-R, using the same cycling conditions described for amplification of fibroblast genomic DNA. The denatured and annealed DNA fragments were treated with 5 units T7E1 at 37°C for 30 min, and then analyzed using agarose gel electrophoresis.
4
CRISPR/Cas9 Genome Editing in iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Streptococcus pyogenes Cas9 target sites were identified using the online CRISPR design tool (https://crispr.mit.edu ) or ChopChop (http://chopchop.cbu.uib.no/ ). Two to three guides were selected per location and in vitro cutting was assessed using HEK293T cells. Finalised gRNAs were selected based on strength of T7E1 assay (New England Biolabs) and proximity to the desired editing loci. iPSCs were dissociated with Accutase, resuspended in mTesR1 supplemented with Y-27632 (Tocris). Dissociated cells were then immediately transfected with 6 μg of PX459 pSpCas9(BB)-2A-Puro V2.0 (Addgene) and 2 μg of phosphorothioate-treated ssODN (Integrated DNA Technologies) using LT-1 (Mirusbio) reagent. Puromycin (0.3 μg/ml to 0.35 μg/ml) (ThermoFisher) was added to the cells 18 h post-transfection for 48-72 h. Following selection, cells were plated at limiting densities for single clone isolation. Isolated iPSC colonies were manually dissected and picked using a 21G needle; selected colonies were then expanded for DNA analysis. Clones were initially screened using diagnostic restriction digest or via PCR specific primers. Positive clones were subsequently confirmed using Sanger sequencing.
5
CRISPR-mediated Humanization of Mouse Genome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The aim of gene editing was to replace the mouse allele at the location in the mouse genome corresponding to rs3820282 in humans, with the human allele. The position rs3820282 and its flanking sequences are 98% conserved between the human and mouse genome (Fig. 1 ). For gene editing, we selected the sgRNAs that bracket the corresponding site in mice based on the on- and off-target scores from the web tool CRISPOR72 (link). The selected sgRNA is constructed in a modified pX458 vector that carries an optimized sgRNA scaffold73 (link) and a high-fidelity Cas9 (eSpCas9 1.1)−2A-GFP expression cassette74 (link). Individual sgRNA editing activity is validated in mouse mK4 cells, using a T7E1 assay (NEB), and compared to the activity of Tet2 sgRNA that has been shown to modify the mouse genome efficiently75 (link). Validated sgRNAs are in vitro synthesized using MEGAshorscript T7 kit (Life Technologies) as previously described76 (link). Injection was made into the cytoplasm of one-cell-stage embryos of the C57BL/6 genetic background using the method described previously76 (link). Injected embryos are immediately transferred into the oviductal ampulla of pseudopregnant CD-1 females. Live born pups are genotyped by PCR and then further confirmed by Sanger sequencing.
6
CRISPR Editing of the MYC G4 Regulatory Region
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The upstream regulatory region sequence containing the G4 of the human MYC locus was extracted using the UCSC genome browser. Guide RNA targeting sequences specific to this locus, and on-target efficiencies were assessed using CRISPOR (http://crispor.tefor.net/crispor.py ). Different sgRNA efficiencies were tested using a T7E1 assay (New England Biolabs, cat #E3321S) and the most efficient guide selected for editing (SI Appendix, Table S4 ). Homology repair templates (HRT) were designed to target the edited site (chr8: (-) 127,735,928-127,735,954) on the DNA leading strand, including upstream and downstream flanking regions, to a total of 200 bp (SI Appendix, Table S5 ). Genotyping was performed by amplicon Sanger sequencing (SI Appendix, Table S6 ). CRISPR editing was performed by plasmid transfection or electroporation (see SI Appendix for further details and genotyping strategy).
7
Detecting CRISPR-Cas9 Genome Edits in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA from the leaves of rice plants was isolated using the CTAB method. The genomic region containing the target site was amplified in the corresponding transgenic plants using site‐specific primers (Table S2) and the high‐fidelity HiFi PCR mixture (TransGen Biotech, Beijing). To detect the mutation, we mixed the PCR product of each transgenic plant with the product generated from the wild‐type plant and then analysed it using the T7E1 assay following a standard protocol (New England Biolabs, MA, USA). Moreover, the PCR products were sequenced directly using the respective forward primer or after cloning into a pEASY‐T vector (TransGen Biotech, Beijing). For each putative mutant event, at least 10 colonies were Sanger sequenced. Specific primers for the LbCpf1, crRNAs and hygromycin phosphotransferase (HPT) cassette were also designed (Table S2) to detect the presence of the T‐DNA fragment.
8
Generating Dmoj/mElo Mutant Alleles in D. mojavensis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate Dmoj/mElo mutant alleles in D. mojavensis, we used a nonhomologous end joining mediated strategy by injecting the mixture of Cas9 protein (PNA Bio, #CP01) and single-guide RNAs (sgRNAs) into the embryos of this species. We coinjected two sgRNAs targeting Dmoj/white (Dmoj/white_sgRNAa and Dmoj/white_sgRNAb) (37 (link)). Dmoj/mElo specific sgRNAs (Dmoj/mElo-sgRNAa and Dmoj/mElo-sgRNAb) were designed using the online tool CRISPR Design (61 (link)), and two sgRNAs were selected. All sgRNAs were generated with in vitro transcription using T7 Megascript Kit (Ambion) and purification using a MegaClear Kit (Ambion) (64 (link)). Primers used for the synthesis of all sgRNAs were listed in table S4. The final injection mixture is composed of Cas9 protein (300 ng/μl) and four sgRNAs, each 75 ng/μl. To screen for the offspring of D. mojavensis carrying Dmoj/mElo mutant alleles, we used the T7E1 assay (NEB, #E3321) to determine potential mutations for every single fly following the protocol in (65 (link)). To eliminate potential off-targets from the gene knockout, all strains carrying mutations in Dmoj/mElo were backcrossed with the parental D. mojavensis strain for at least five generations before being made homozygous.
9
CRISPR-Cas9 Mutagenesis in Hofstenia
10
Generation of STAG1 and STAG2 Knockout Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CAL-51 cells were transduced with a lentiviral vector containing Cas9sp (GeCKO-tEf1aCas9Blast, Sigma-Aldrich) and blasticidin resistance marker. After 10 days of treatment with blasticidin (25 ug/ml), resistant cells were selected and Cas9sp expression was verified via PCR (Supplementary Table 2 ). STAG1 and STAG2 crRNAs (Sigma-Aldrich, Supplementary Table 2 ) were co-transfected with 69-mer tracrRNA (Sigma-Aldrich) together with GeneArt Platinum Cas9 nuclease (Life Technologies) using lipofectamine CRISPRMAX (Life Technologies). The per cent of edited cells was assessed 72 hours after transfection using the T7E1 assay (New England Biolabs) as reported above.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!