Silicone elastomer base & curing agent (Sylgard® 184) were ordered from Dow Corning Co. (Midland, MI). Penicillin-streptomycin (pen/strep), G418 disulfate, collagen I, N-acetyl-D,L-penicillamine, acetic anhydride, calcein-AM, hydrogen peroxide, di-tert-butyl peroxide, and cyclam were obtained from Sigma-Aldrich (St. Louis, MO). Tert-butyl nitrite was purchased from Acros Organics, (Pittsburgh, PA). Gelatin was obtained from Bio-rad (Hercules, CA). Pyridine was purchased from EMD Chemical Inc. (Darmstadt, Germany). Ethidium bromide, Click-iT® EdU assay kit and Hoechst dye were purchased from Invitrogen (Grand Island, NY). Smooth muscle cell line MOVAS, Dulbecco's modified eagle medium (DMEM), fetal bovine serum (FBS), were all purchased from ATCC (Manassas, VA).
G418 disulfate
Manufactured by Merck Group
G418 disulfate is a common laboratory reagent used as a broad-spectrum antibiotic for the selection and maintenance of cell lines expressing antibiotic resistance genes. It inhibits protein synthesis in eukaryotic cells.
Automatically generated - may contain errors
Lab products found in correlation
Ripa lysis buffer, by Thermo Fisher Scientific (2 mentions)
Ethidium bromide, by Thermo Fisher Scientific (1 mentions)
Gelatin, by Bio-Rad (1 mentions)
Cyclam, by Merck Group (1 mentions)
Penicillin streptomycin pen strep, by Merck Group (1 mentions)
Collagen 1, by Merck Group (1 mentions)
Hoechst dye, by Thermo Fisher Scientific (1 mentions)
Movas, by American Type Culture Collection (1 mentions)
Click it edu assay kit, by Thermo Fisher Scientific (1 mentions)
N acetyl d, by Merck Group (1 mentions)
Di tert butyl peroxide, by Merck Group (1 mentions)
L penicillamine, by Merck Group (1 mentions)
Tert butyl nitrite, by Thermo Fisher Scientific (1 mentions)
Calcein am, by Merck Group (1 mentions)
Sylgard 184, by Dow (1 mentions)
Hydrogen peroxide, by Merck Group (1 mentions)
Acetic anhydride, by Merck Group (1 mentions)
Thiabendazole tbz, by Merck Group (1 mentions)
Hygromycin b, by Sangon (1 mentions)
Ptarget mammalian expression vector, by Promega (1 mentions)
8 protocols using g418 disulfate
1
Sylgard 184 Elastomer Characterization
2
Synthetic Lethality Screening of Kinetochore Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard media [either YE (yeast extract) rich medium or EMM (Edinburgh minimal medium)] and culturing methods were used (Moreno et al. 1991 (link); Forsburg and Rhind 2006 (link)). G418 disulfate (Sigma-Aldrich), hygromycin B (Sangon Biotech), or nourseothiricin (clonNAT; Werner BioAgents) was used at a final concentration of 100 μg/ml and thiabendazole (TBZ) (Sigma-Aldrich) at 5–15 μg/ml in YE media. For serial dilution spot assays, 10-fold dilutions of a mid-log-phase culture were plated on the indicated media and grown for 3–5 days at indicated temperatures. To examine the possible synthetic lethality (SL) of genetic combinations between alleles of GBP-mCherry, GFP-tagged kinetochore proteins, and spindle checkpoint mutants mad2Δ or bub1Δ, normal-looking 4-spore asci obtained after crosses between parental strains were dissected using a micromanipulator. At least 20 complete tetrads were dissected after each genetic cross, and the genotypes of colonies formed from germinated spores were deduced after being replicated on selective plates. The frequency of spores with expected genotypes failing to germinate was quantified, it was classified as SL, strong growth defect, or normal growth when the frequency was above 80%, between 20% and 80%, or below 20%, respectively. Yeast strains used and created in this study are listed in Supplementary Table S1 .
3
PU.1 Overexpression in K562 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PU.1 cDNA was obtained by reverse transcription from K562 total RNA extracts and amplification with following primers (IDT): F: TGACGGATCC GCCGCCACCATGTTACAGGCGTGCAAAATG, R: TGACGCGGCCGCTCAGTGGGGCGGGTGG that amplify from start to stop codons of PU.1 cDNA with addition of a Kozak sequence, and BamHI and NotI recognition sites. BamHI and NotI double digest (NEB) was used to clone the amplified cDNA into the pTargeT mammalian expression vector (Promega), and the insert was verified with Sanger sequencing. The PU.1 overexpression construct or empty pTarget was introduced to 0.5 million K562 cells by transfection with Lipofectamine LTX with Plus reagent (Thermo Fisher Scientific) following manufacturer’s protocol. 24 h following transfection, media were supplemented with 400 μg/mL G418 disulfate (Sigma-Aldrich) for 12–14 days of selection. Following selection, G418 concentration was reduced to 250 μg/mL and cells were expanded for 3–4 days. Overexpression was verified by qPCR or western blot on days cells were subjected to DNase-seq.
4
Plasmid Transformation and Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Competent TOP10 Escherichia coli cells were transformed by heat shock using 50 ng of plasmid DNA, allowed to recover in SOC (super optimal broth with catabolite repression) medium, then plated on ampicillin agar plates and incubated at 37 °C overnight. Single colonies were expanded in Luria–Bertani (LB) medium incubated on a shaker at 37 °C and 220 r.p.m. overnight. Plasmid DNA was extracted using the PureYield Plasmid Miniprep System (Promega), and DNA concentration was determined using a NanoDrop 8000 spectrophotometer (Thermo Fisher Scientific). Transfection was performed on log(phase) U2OS cells using 4 µg of plasmid DNA and jetPEI transfection reagent (Polyplus-Transfection), according to the manufacturer’s protocol. Successful and stable plasmid integration was maintained by culturing the cells in complete medium supplemented with 250 μg ml−1 of G418 disulfate (Sigma-Aldrich).
5
Stable S100A10 Overexpression in CRC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Flexi HaloTag clone pFN21AB8860, an S100A10 expression vector capable of producing N-terminally HaloTag-fused recombinant S100A10 protein, was obtained from Kazusa DNA Research Institute (Kisarazu, Japan). The S100A10-nonexpressing CRC cells, that is, COLO-320 cells, were plated at a density of 3 × 105 cells per 35-mm dish 24 h prior to transfection. Cells were transfected with either S100A10 in the pFN21AB8860 (COLO-320/S100A10) or with the vector control (COLO-320/vector) using TransIT-LT1 transfection reagent (Mirus, WI, USA) according to the manufacturer’s instructions. Cells stably expressing S100A10 were selected with 0.8 mg/mL of geneticine (G418 disulfate, Sigma-Aldrich) and subsequent subcloning. COLO-320/S100A10 cells were maintained in medium containing 0.4 mg/mL G418 disulfate. Stable expression of S100A10 in the cells was verified using western blot analysis.
6
Stable HEK293T-ACE2 Cell Line Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were seeded at 1.7 × 105 cells/cm2 within 10 mL of DMEM with 10% FBS and 1% penicillin-streptomycin in a T-75 flask. The next day, 5 µL of pcDNA3.1-hACE2 plasmid (Addgene) was mixed with 0.1 mL of PEI for 30 min and then added to the cells for transfection. The culture medium was replaced with a fresh one. After 48 h, 500 µg/mL G418 disulfate (Sigma-Aldrich) was used for selection for up to four weeks. The stable HEK293T cell line expressing hACE2 (HEK293T-ACE2) on the surface of the outer cell membrane was confirmed by incubating HEK293T-ACE2 cells with anti-ACE2 mAb for 1 h at room temperature. Following three gentle PBS washes, cells were treated for 25 min at room temperature with a fluorescent secondary antibody: anti-mouse IgGκ binding protein conjugated with red fluorescent dye CruzFluorTM 594 (Santa Cruz Biotechnology). A Leica DMi8 microscope equipped with a Leica EC3 camera (Leica Microsystems, Wetzlar, Germany) was used to image the cells. Western blot analysis was performed in HEK293T-ACE2 cells by using RIPA lysis buffer (Thermo Fisher Scientific). Briefly, after performing SDS-PAGE for the cell lysate, the gel was transferred onto the nitrocellulose membrane. ACE2 mAb and HRP-conjugated mouse IgG secondary antibodies were used for Western blot detection.
7
Stably Transfected HEK293 Cell Lines
8
Generating MDA-MB-231/EGFP Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate MDA-MB-231/EGFP, MB-231 cells were transfected with the plasmid pEGFP-C3 (BDBiosciences, San Jose, CA). The plasmid was linearized at the AseI restriction site and used to transfect cells using FuGENE HD Transfection Reagent (Promega, Madison, WI; https://www.promega.com/ ) according to the supplier’s specifications. Stable clonal transfectants were obtained by selection with 330 µg/ml of G418 disulfate (Sigma, St. Louis, MO).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!