Psuper retro puro retroviral vector

LRRC8A silencing with shRNA was performed using retrovirus mediated gene transfer as described previously [4 (link),26 (link)]. To generate retrovirus expressing shRNA against LRRC8A, the target sequences (Table 1) were inserted into the pSUPER.retro.puro retroviral vector (OligoEngine, Seattle, WA, USA). As a control, a non-targeting sequence 5′-ATAGTCACAGACATTAGGT-3′ was introduced. Cloned cell lines stably expressing shLRRC8A showed prominent suppression of LRRC8A mRNA but almost no effects on the expression of other LRRC8 isoforms (LRRC8A-E) in three breast cell lines (Supplemental Figure S1).

The open reading frame (ORF) of human SNAI1 (Gene symbol; SNAI1) was amplified by PCR and subcloned into the pMXs-IN vector. The ORFs of human PRKCA, PRKCG and BICD2 were amplified and subcloned into pcDNA3.1 (Invitrogen, Carlsbad, CA, USA). We have confirmed that none of these sequences contain mutations. Halo-tagged ARHGEF18 and PRKCB (PKCβ) were obtained from Promega (FHC01977 and FHC10533, respectively). The pSUPER retro puro retroviral vector (Oligoengine) was used for short hairpin RNA (shRNA) expression with the following targeting sequences: shPKCγ-#1, 5′- GGCCATCATGGAACAAACTGT -3′; and shPKCγ-#2, 5′- GCGAGAACTTTGACAAGTTCT -3′. To obtain stable cell lines, transfected cells were selected with 1 μg/mL puromycin (P8833, Sigma) or 1,000 μg/mL G418 (10131035, Thermo) and the resulting single clones were analyzed for stable expression.
Negative control siRNA (siNeg) and siRNAs for PKCγ (Qiagen, Hilden, Germany) were used at final concentrations of 20 nM. Transient transfections were performed using polyethylenimine, Lipofectamine 2000, or Lipofectamine RNAi max (Invitrogen), according to the manufacturer’s protocols. In every experiment, the total amount of transfected DNA or siRNA was adjusted using the relevant empty vector or negative control siRNA, respectively.