The largest database of trusted experimental protocols

Lv atg7

Manufactured by Genechem
Sourced in China

LV‐Atg7 is a laboratory equipment product used for genetic manipulation. It is designed to enable the overexpression of the Atg7 gene, which is involved in the autophagy process. The core function of LV‐Atg7 is to facilitate the introduction and expression of the Atg7 gene in cell lines or model organisms for research purposes.

Automatically generated - may contain errors

2 protocols using lv atg7

1

Lentiviral Transfection of NP Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The NP cells reaching 40‐60% confluence were transfected using lentivirus (LV‐siHuR was from Cell‐land, China, TACCAGTTTCAATGGTCATAA; LV‐HuR was from OBiO, China, NM_001108848; and LV‐Atg7 was from GeneChem, China, NM_001012097) at a multiplicity of infection (MOI) of 50.
+ Open protocol
+ Expand
2

Autophagy Regulation in Inflammation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sodium taurocholate (Na-TC) and sodium pentobarbital were purchased from Sigma-Aldrich (St. Louis, MO, USA). Lentiviral vectors encoding ATG7 (Lv-ATG7) or CAMKII (Lv-CAMKII) and lentivirus with scrambled sh-ATG7 (Lv-sh-ATG7) or sh-CAMKII (Lv-sh-CAMKII) were purchased from GeneChem (Shanghai, China). MiR-30b-5p mimic and mimic negative control were purchased from RiboBio (Guangzhou, China). The primary antibodies used for Western blot were microtubule-associated protein 1 light chain 3 (LC3), p62, ATG7 and high mobility group protein B1 (HMGB1) purchased from Cell Signaling Technology (Danvers, MA, USA), tumor necrosis factor α (TNF-α), β-actin and interleukin-1β (IL-1β) purchased from Santa Cruz Biotechnology (Dallas, Texas, USA), CAMKII purchased from Abcam (Shanghai, China), and lysosome-associated membrane protein-2 (LAMP-2) purchased from Thermo Fisher Scientific (Rockford, IL, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!