Pmirglo plasmid

RNA22 (see text footnote 1) and starBase V2.0³ were employed to screen for potential target lncRNAs and genes of miR-210-3p, among which DLEU2L and breast cancer type 2 susceptibility protein (BRCA2) were selected, respectively. Binding sites between miR-210-3p and DLEU2L or the 3′ untranslated region (UTR) of BRCA2, were identified, and wild-type (WT) and mutant (MUT) 3′UTR segments of the binding sites were prepared based on the predicted sequences. Transfection was performed with pmirGLO plasmids (Addgene, Watertown, MA) using the LucPair^TM Duo-Luciferase Assay Kit (LF001, GeneCopoeia, Rockville, MD). After transfected cells were cultured with miR-210-3p mimics or negative control (NC), the signal of firefly luciferase and renilla luciferase was detected using a Glo-MAX 20/20 analyzer.

The starBase V2.0 web site was employed to screen for miRNAs that bind to the 3′UTR of hTERT, and seven‐base binding sites to miR‐1255b‐5p were identified at three regions (1278–1284 bp, 1309–1315 bp, and 1420–1427 bp; GenBank AB085628.1, Ensembl ENSG00000164362) of the hTERT promoter. Reporter plasmids were constructed using pmirGLO plasmids (Addgene) according to the manufacturer's instructions. Wild‐type (WT) and mutant (MUT) 3′UTR segments were prepared as follows: hTERT 1278–1284 WT, 5′‐CTAGCACAGGAGGCTTCAGGGTGGGGCTGGTGATGCTCTCTCATCCTCTTATCATCTCCCAGTCTCATCT‐3′, MUT, 5′‐CTAGCACAGGAGGCTTCAGGGTGGGGCTGGTGATGCTCTCATCCTCTCTTATCATCTCCCAGTCTCATCT ‐3′; hTERT 1309–1315 WT, 5′‐CTAGCTCTTATCATCTCCCAGTCTCATCTCTCATCCTCTTATCATCTCCCAGTCTCATCTGTCTTCCTCT‐3′, MUT, 5′‐CTAGCTCTTATCATCTCCCAGTCTCATCTCATCCTCTCTTATCATCTCCCAGTCTCATCTGTCTTCCTCT ‐3′; hTERT 1420–1427 WT, 5′‐CTAGCCTCATCTCTTATCCTCTTATCTCCTAGTCTCATCCAGACTTACCTCCCAGGGCGGGTGCCAGGCT‐3′, MUT, 5′‐CTAGCCTCATCTCTTATCCTCTTATCTCCTAGTCATCCTCAGACTTACCTCCCAGGGCGGGTGCCAGGCT‐3′. A dual‐luciferase activity kit (LucPair™ Duo‐Luciferase Assay Kit, LF001; GeneCopoeia, Rockville, MD, USA) was employed to detect the signal of firefly luciferase and renilla luciferase using a Glo‐MAX 20/20 analyzer.

Luc-3'-UTR of FSTL3 and mutant form were separately subcloned into the pmirGLO plasmid (Addgene, USA) to establish wt-FSTL3-luc (WT) and mut-FSTL3-luc (Mut) plasmid constructs respectively. The miRNA mimic, internal control, and parental luciferase plasmid were co-transfected into cells. Luciferase activity was assayed 48 h after transfection using the Dual-Luciferase Reporter Assay System (Promega, USA).