Stealth sirna duplex oligoribonucleotides

Rabbit MSCs were cultured as before. At about 60% confluence, MSCs were transfected with the stealth siRNA duplex oligoribonucleotides (Invitrogen Life Technologies, Carlsbad, CA, USA). The sequence of the stealth siRNA duplex oligoribonucleotides against CXCR4 is 5′- GCCCUCAAGACUACGGUCAUCCUUA -3′, and its corresponding complementary strand is 5′- UAAGGAUGACCGUAGUCUUGAGGGC -3′ (Invitrogen Life Technologies). A negative stealth siRNA sequence was used as a control. The CXCR4 siRNA was transfected transiently using LipofectamineTM RNAiMAX (Invitrogen Life Technologies) according to the manufacturer’s instructions. Briefly, siRNA plasmid (150 pmol) was diluted in 245 µL of Opti-MEMI (Gibco, Waltham, MA, USA) and the solution was gently mixed. Lipofectamine™ RNAiMAX (Invitrogen Life Technologies) was gently mixed and 4 µL of the reagent was then diluted in 246 µL of Opti-MEMI. Then, the diluted siRNA and the diluted LipofectamineTM RNAiMAX were combined for 20 min at room temperature to allow the formation of transfection complexes. The final volume of these solutions was 0.5 mL, and the final concentration of RNA was 40 nM. The complexes were then added to each well containing cells in six-well plates while they were in the quiescent state, and all were swirled gently to ensure uniform distribution. After incubation at 37 °C for 48 h, IF staining and WB were performed.

Cells were transfected using Lipofectamine 2000 (Invitrogen, Life Technologies) according to the manufacturer’s instructions and incubated for 48 h before analysis. Expression plasmids for hPrickle1, hVangl2 and cDNA control were a kind gift (provided respectively by Dr. A. Bassuk at the University of Iowa and Dr. L. Braiterman at the Johns Hopkins University School of Medicine). Silencing RNA (siRNA) hairpins (Stealth siRNA duplex oligoribonucleotides) complementary to human Prickle1 and Vangl2 mRNAs were designed by Invitrogen. Alternative siRNA sequences (Santa Cruz Biotechnology, Dallas, Texas USA), complementary to human Prickle1 and Vangl2 mRNAs were used in confirmative transfection experiments. The siRNAs used were a pooled cocktail with three different siRNA sequences. β-catenin knockdown was achieved using the SignalSilence β-catenin kit (Cell Signaling Technology, Beverly, MA). Non-silencing siRNA was used as control (Cell Signaling Technology). The final concentration of RNA when added to the cells was 33 nM.

For the knockdown of human Pin1, the siRNAs against Pin1 (Pin1 shRNA-1: 5’-CGGCAACAGCAGCAGUGGUGGCAAA-3’ and Pin1 shRNA-2: 5’-GCCCUGGAGCUGAUCAACGGCUACA-3’) and control siRNA were purchased from Invitrogen (Stealth/siRNA duplex oligoribonucleotides), and transfected into LNCaP or DU145 cells using Lipofectamine RNAi Max (Invitrogen, CA), according to the manufacturer’s instructions.