Hiscript 3 all in one rt supermix perfect for qpcr

FastPure^® Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, China) was used to extracted RNA. Hairpin-itTM microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit (GenePharma, China) was used for miRNA. For RNA, HiScript^®III All-in-one RT SuperMix Perfect for qPCR (Vazyme Biotech, China) was used for reverse transcription and Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech, China) was used for qPCR. Results were obtained using the CFX96TM Real-time System 3.1 software (Applied Bio-Rad). A minimum of 3 replicate wells were set up for each sample and further analyzed using the 2^−ΔΔct method with U6 as the internal reference gene. All primers used in qPCR were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The primer sequences were as follows: miR-588, forward GATGCTCTTTGGCCACAATG, and reverse TATGGTTGTTCTGCTCTCTGTCTC; U6, forward CGCTTCGGCAGCACATATAC, and reverse TTCACGAATTTGCGTGTCATC; CCL5, forward ATTTGCCTGTTTCTGCTTGCTCTTG, and reverse AACTGCTGCTGTGTGGTAGAATCTG; TGF-β, forward AAGGTGAGGAAACAAGCCCAGAG, and reverse AAGTGCTAGGATTACAGGCGTGAG; GAPDH, forward AGATCCCTCCAAAATCAAGTGG, and reverse GGCAGAGATGATGACCCTTTT.

DMEM, FBS, and streptomycin/penicillin were purchased from Gibco (California, USA). Epigallocatechin-3-gallate (EGCG) and 3-Methyladenine (3-MA) were purchased from Sigma-Aldrich (Darmstadt, Germany). The CCK-8 assay kit was purchased from GlpBio (California, USA). HiScript® III All-in-one RT SuperMix Perfect for qPCR and Taq pro Universal SYBR qPCR Master Mix were purchased from Vazyme (Nanjing, China).

Breast muscle tissue was utilized for total RNA extraction using Trizol reagent (Invitrogen Life Technologies, Shanghai, China). The cDNA was then synthesized using HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme, Nanjing, China) for reverse transcription. Primers were designed using the NCBI Primer Design Tool. The cDNA samples were subjected to ChamQ Universal SYBR qPCR Master Mix (Vazyme) according to the manufacturer's protocol. The $2^{-\Delta \Delta Ct}$ method and internal normalization were used to analyze the quantification results (Livak and Schmittgen, 2001 (link)). The information on primers used for qPCR amplification is listed in Table S1.

Total RNA was extracted using TRIzol reagent (Invitrogen, 15596026CN), and cDNA was synthesized using HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme, R333–01). qPCR was performed using SYBR qPCR master mix (Vazyme, Q711–02) on a Bio-Rad CFX Connect. The primer sequences used were as follows: m-IL-2 forward 5’-TGAGCAGGATGGAGAATTACAGG-3’ and reverse 5’-GTCCAAGTTCATCTTCTAGGCAC-3’.