We selected five of the most significant SNPs (rs7572473, rs12473679, rs17529497, rs7605378, and rs10203122) of FTCDNL1 based on a previous study with a minimum allele frequency of ≥ 1% in a Beijing Han Chinese population[17 (link)]. The FTCDNL1 gene structure is shown in Fig 1 . Genotyping was performed by the TaqMan Allelic Discrimination assay (Applied Biosystems, Foster City, CA). The polymerase chain reaction (PCR) was accomplished by an ABI StepOnePlus Thermal Cycler. In a subsequent PCR, the fluorescence from specific probes was detected and analyzed through the System SDS software version 2.2.2 (Applied Biosystems).
Stepone plus thermal cycler
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, United Kingdom
The StepOne Plus thermal cycler is a real-time PCR system designed for a wide range of applications, including gene expression analysis, SNP genotyping, and microRNA profiling. It features a compact design, intuitive software, and reliable performance to support your research needs.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (28 mentions)
Rneasy mini kit, by Qiagen (15 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (10 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (6 mentions)
Primescript rt master mix, by Takara Bio (5 mentions)
Sybr premix ex taq, by Takara Bio (5 mentions)
Rneasy plus mini kit, by Qiagen (5 mentions)
Quantitect reverse transcription kit, by Qiagen (5 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Sybr select master mix, by Thermo Fisher Scientific (4 mentions)
Rneasy, by Qiagen (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Multiscribe reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Soadvanced universal sybr green supermix, by Bio-Rad (3 mentions)
Iscript advanced cdna synthesis kit, by Bio-Rad (3 mentions)
Tnf α, by Qiagen (3 mentions)
Interleukin 6 (il 6), by Qiagen (3 mentions)
Sybr select gene expression master mix, by Thermo Fisher Scientific (3 mentions)
Nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
112 protocols using stepone plus thermal cycler
1
Genotyping of FTCDNL1 SNPs
2
RNA Extraction and qPCR Analysis of Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cell cultures and tissues using a RNeasy Plus Mini kit (Qiagen, Germany) according to the manufacturer’s instructions and then quantified by absorption at 260 nm as previously described [31 (link)]. cDNA was synthesized with a PrimeScript™ RT Master Mix (Takara, Japan) and used for qPCR with SYBR® Premix Ex Taq™ (Takara) in a StepOnePlus thermal cycler (ABI, USA). The GAPDH gene was used as an internal control. The PCR primer sequences are listed in Table 1 .
Primer sequences
| Forward | Reverse | |
|---|---|---|
| Human-GAPDH | CGTATTGGGCGCCTGGTCAC | ATGATGACCCTTTTGGCTCC |
| Human-cyclin A2 | CGCTGGCGGTACTGAAGTC | GAGGAACGGTGACATGCTCAT |
| Human-KLF4 | TCTCAAGGCACACCTGCGAA | TAGTGCCTGGTCAGTTCATC |
| Human-p21 | TGTCCGTCAGAACCCATGC | AAAGTCGAAGTTCCATCGCTC |
| Human-p27 | TAATTGGGGCTCCGGCTAACT | TGCAGGTCGCTTCCTTATTCC |
| Human-PAR2 | TTGTGTTTGTGGTGGGTTTGC | ACCAGATGACAGAGAGGAGGT |
| Human-PDK2 | CTTCAGCAAGTTCTCCCCGTC | TCGGGAAGCAGGTTGATCTCT |
| Human-PDK1 | AGAGGGTTACGGGACAGATGC | GTCTTTGGGTTCTCTGCTGGG |
| Human-AKT | GGAGAGGAAGAGATGGATGCCT | CCACTTGCCTTCTCTCGAACC |
| Human-PI3K | AACACCGACCTCACAGTTTTT | CTCAAGCCACACATTCCACAG |
| Human-cyclin B1 | GGTTGTTGCAGGAGACCATGT | AACATGGCAGTGACACCAACC |
| Human-cyclin D1 | TTCATTTCCAATCCGCCCTCC | TGTGAGGCGGTAGTAGGACAG |
| Human- FAK | GTTATCCCAGTCCGAGGTCCA | TGACCTGGATAGATGCTGCCA |
| Human- CRALBP | AGCTGCTCAGAGGCTATGTGA | CCAGGGTAGCCAGCTTCAATG |
| Human- PEDF | TTCAAAGTCCCCGTGAACAAG | GAGAGCCCGGTGAATGATGG |
3
Comprehensive miRNA Profiling via S-Poly(T) Plus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The polyadenylation, reverse transcription and Real-time PCR procedure were conducted exactly according to S-Poly(T) Plus protocol21 (link). To profile miRNAs effectively, every 7 out of 485 miRNAs as well as spiked-in cel-miR-54 were grouped together for the one-step reaction of polyadenylation and reverse transcription, simultaneously. miRNAs with identical forward primers or with more than five base-pairings between the forward primer and RT primers have been avoided in the same group. All sequences, primers and probes were listed in the Supplemental Table 1 . Besides, the S-Poly(T) Plus assay was evaluated by comparing with TaqMan microRNA assay kit (Applied Biosystems) according to the manufacturer’s instructions. No-template control (NTC) and no-reverse transcriptase control (-RT) were conducted simultaneously.
Real-time PCR was performed in 96-well plates by using ABI StepOne Plus thermal cycler. Each PCR reaction was carried out in duplicate. The miRNA expression level was normalized to spiked-in cel-miR-54-5p. miRNAs with cycle threshold (Ct) value less than 35 in the panel were included in data analysis.
Real-time PCR was performed in 96-well plates by using ABI StepOne Plus thermal cycler. Each PCR reaction was carried out in duplicate. The miRNA expression level was normalized to spiked-in cel-miR-54-5p. miRNAs with cycle threshold (Ct) value less than 35 in the panel were included in data analysis.
4
Quantifying Mature miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA for miRNA was synthesized from total RNA. Reverse transcription of specific mature miRNAs was performed using TaqMan miRNA assays according to the manufacturer’s protocol (ABI). The PCR amplification and reading were conducted in triplicate using the StepOnePlus thermal cycler (ABI). Mature miRNA expression was quantified under the following thermal cycler conditions: 2 min at 50 °C, 10 min at 95 °C and 40 amplification cycles (15 s at 95 °C and 1 min at 60 °C). Expression values were calculated based on the comparative threshold cycle (Ct) method. U6 snRNA was used for miRNA levels normalization.
5
CD209 Genetic Variant Analysis in Han Chinese
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Utilizing the Han Chinese in Beijing as a reference population sample from the haplotype map database (http://www.hapmap.org ), we selected the nine tagging SNPs of CD209 (rs8112310, rs4804800, rs11465421, rs1544766, rs4804801, rs2287886, rs735239, rs735240, and rs4804804) with a minimum allele frequency of greater than 1% in the Beijing Han Chinese population. There are 4 SNPs (rs4804800, rs11465421, rs1544766, rs4804801) located on 3′ UTR, and 5 SNPs (rs8112310, rs2287886, rs735239, rs735240, rs4804804) near 5′ UTR. Genotyping was performed by using TaqMan Allelic Discrimination assay, and the polymerase chain reaction (PCR) was accomplished by using ABI StepOnePlus Thermal Cycler. Followed up in PCR, the fluorescence was detected and analyzed through the System SDS software version 2.2.2.
6
Differential Expression of Genomic Markers in SAH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study, quantitative real time PCR was performed to examine the expression of lncRNA-HOXA11-AS, miR-15a, TNF-α and NF-κB in the peripheral blood and CSF samples collected from the SAH patients carrying different genotypes of rs17427875. In brief, the total RNA content in each cell and tissue sample was extracted by making use of the Oligotex mRNA mini assay set according to the kit’s instruction. Then, an MMLV High Performance Reverse Transcriptase (Epicentre, Madison, WI, USA) was used in accordance with the recommended assay protocol provided by the manufacturer on the manual of the assay kit to convert the extracted RNA into cDNA, which was used in conjunction with a Hotstar Taq Polymerase real time PCR kit (Cat.no. AB-RPP-0005; Geneup, Shenzhen, China) on a StepOnePlus thermal cycler (ABI, Foster City, CA, USA) to carry out the Real-time PCR reactions. Finally, the relative expression of lncRNA-HOXA11-AS, miR-15a, TNF-α, and NF-κB in each sample was calculated based on the Ct value of amplification curves using the 2−ΔΔCt approach.
7
Palladin Expression Quantification in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cell lines was extracted using TRIzol reagent, according to the manufacturer’s instructions (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription reaction was conducted using High-Capacity cDNA Reverse Transcription Kit with random primers (ABI). The expression of mRNA was tested using SYBR Green PCR Master Mix (ABI). PCR amplification and reading was done in triplicates using the StepOnePlus thermal cycler (ABI). Palladin expression values were calculated based on the comparative threshold cycle (Ct) method and normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
8
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared by hot acid phenol extraction from three independent biological replicates per experimental condition. The ImProm-II reverse transcription kit (Promega) was used to synthesize cDNA from 1 μg of total RNA using the included oligo dT primers in a volume of 20 μL per the manufacturer’s direction. After cDNA synthesis, the cDNA reaction was diluted with ultrapure dH2O to a final volume of 100 μL, and 1 μL of the diluted cDNA was used to perform gene-specific qPCR using SYBR Green reagent and an ABI StepOne Plus thermal cycler. The gene specific signal was normalized to the SPT15 internal reference control gene using the formula 2(CtSPT15-CtTarget) as previously described. The mean and standard deviation for each gene were calculated and are plotted in Figure S4 and Figure S7 . These means then were Log2 converted and used to generate the heat map results for Figures 2 and Figure 5 . Primer sequences used in this study are in Supplemental File 1 . All statistical analyses and graphs were generated using GraphPad Prism 10.
9
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cell cultures and tissues using an RNeasy Plus Mini kit (Qiagen, Germany) and RNeasy Fibrous Tissue Mini kit (Qiagen) according to the manufacturer's instructions and then quantified by absorption at 260 nm. cDNA was generated using a PrimeScript™ RT Master Mix (Takara, Japan). Finally, 500 ng of cDNA was used for qPCR. qPCR was performed using a StepOnePlus thermal cycler (ABI, USA) and SYBR® Premix Ex Taq™ (Takara). Relative expression levels were normalized to GAPDH. The PCR primer sequences are listed in Table S1 .
10
Transcriptomic Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolation was carried out using an RNA purification Kit (Promega, Madison, WI, USA) and reverse-transcribed to cDNA using M-MLV reverse transcriptase with RNase inhibitor (Takara Bio, Beijing, China). qPCR was performed in triplicate with RealStar Green Fast Mixture (A303, GenStar, Beijing, China) and on a StepOnePlus thermal cycler (ABI, Thermo Fisher, MA, USA). Threshold cycle numbers were normalized to triplicate samples amplified with primers specific to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). qPCR primers for the target genes are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!