The polymorphic variants mentioned in Table 1 were genotyped by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). PCR amplification was carried out in a final volume of 25 µL using a DNA Engine Dyad Thermocycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The reaction mixture consisted of 100 ng of genomic DNA, 0.25 µM of each primer (TiBMolBiol, Berlin, Germany), 1 U of Taq DNA polymerase and respective buffer (DreamTaq Green DNA polymerase, Thermo Fisher Scientific, Waltham, MA, USA), 200 µM dNTP Mix (Thermo Fisher Scientific, Waltham, MA, USA) and deionized water. PCR reaction conditions were optimized for each polymorphism. Characteristics of the polymorphisms and the specific primer sequences are shown in Table 2 . Amplified fragments were then digested with the appropriate restriction enzyme (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions, and visualized after electrophoresis on 2% or 3% agarose gel with Midori Green Advanced DNA Stain (Nippon Genetics, Europe GmbH, Düren, Germany).
Dna engine dyad thermocycler
Manufactured by Bio-Rad
Sourced in United States
The DNA Engine Dyad Thermocycler is a laboratory instrument designed for performing polymerase chain reaction (PCR) amplification of DNA samples. It features two independent heating blocks that can be programmed to run separate protocols simultaneously. The device precisely controls the temperature and cycling required for the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Dntp mix, by Thermo Fisher Scientific (1 mentions)
Dreamtaq green dna polymerase, by Thermo Fisher Scientific (1 mentions)
Midori green advanced dna stain, by Nippon Genetics (1 mentions)
Spin x centrifuge tube filter, by Corning (1 mentions)
Prominence 12 32mm mt it autosampler vials, by Shimadzu (1 mentions)
Ptfe silicone septa, by Avantor (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Quick rna miniprep kit, by Zymo Research (1 mentions)
Biophotometer plus, by Eppendorf (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
3 protocols using dna engine dyad thermocycler
1
Genotyping of Polymorphic Variants
2
Enzymatic Assay of Gk CblS Protein
3
Quantitative Real-Time PCR for Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Quick-RNA™Miniprep Kit (Zymo Research, USA) according to the manufacturer recommendations. The quantity and purity of extracted RNA were determined using Eppendorf BioPhotometer plus (Eppendorf, Austria). The cDNA synthesis was carried out using High Capacity cDNA Reverse Transcription kit (ThermoFischer Scientific, USA) and the reaction was performed on BioRad DNA ENGINE Dyad thermocycler. For each reaction 2 μg of total RNA have been used. Quantitative real-time PCR was performed on StepOne Plus Real-Time PCR System (ThermoFischer Scientific, USA) platform. The IL-1β, IL-6, TNF-α mRNA and GAPDH (as endogenous control) level of expression was quantified using Universal SYBR Green Master (Rox) (ThermoFischer Scientific, USA) and gene-specific primers: mIL-6 (Fw: CAACGATGATGCACTTGCAGA, R: TGGAAATTGGGGTAGGAAGGAC), m T N F -α (Fw: TTCTATGGCCCAGACCCTCA, R: GTGGTTTGCTACGACGTGGG), mIL-1β (Fw: TGCCACCTTTTGACAGTGATG, R: AAGGTCCACGGGAAAGACAC), and mGAPDH (Fw: GGGTCCCAGAGGTTCATC, R: ATCCGTTCACACCGACCTTC). Each experiment was performed three times. The relative mRNA expression was calculated as "fold change" (RQ): 2 -ΔΔCt using StepOne Software v2.3.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!