Silanized slides

Cryostat sections, cut serially at 6 µm thickness, were mounted on silanized slides (Dako Japan, Tokyo, Japan), and a rabbit polyclonal antibody to ssDNA (Immuno-Biological Laboratories Co., Ltd., Fujioka, Japan) or TLR2 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Immunohistochemical staining was performed with a streptavidin-biotin peroxidase method according to the manufacturer's instructions with the ImmunoCruz rabbit LSAB Staining System (Santa Cruz Biotechnology, Inc.). Counterstaining was performed with methyl green.

Respective paraffin sections of CRC tumors and xenografts were histologically examined by hematoxylin and eosin staining. Expression of TPR in tumor tissues was immunohistochemically examined using an avidin-biotin-peroxidase complex method described in our previous studies [15 (link)]. Representative paraffin sections placed on silanized slides (Dako) were treated by microwaving in citrate buffer to unmask antigens, incubation with 0.3% H₂O₂ in methanol, and subsequent incubation with 10% normal goat serum to block non-specific immunohistochemical reactions. Pretreated tissue sections were incubated with a rabbit polyclonal antibody against TPR (diluted 1:100; Santa Cruz). After incubation with the antibody, sections were incubated with biotinylated goat anti-rabbit IgG (Vector Laboratories) diluted 1:200 in PBS containing 10% normal goat serum. For mouse xenograft tumors, final concentrations of 1% bovine serum albumin and 10% normal mouse serum (DakoCytomation) were added to the diluent of anti-rabbit IgG to prevent cross-reaction with endogenous mouse IgG [14 (link), 15 (link)].

For tissue samples, 5-μm thick serial paraffin sections were collected onto silanized slides (DAKO, Sta Clara, CA, USA) and deparaffinized in 2 consecutive 5 min xylene washes. One section was stained with hematoxylin and eosin (H&E). The others were rehydrated in two 3-min washes of 98% and 90% ethanol each and once in DEPC-treated distilled water for 5 min14 (link),15 (link). Sections were then incubated in 2.5 μg/ml Proteinase K (Invitrogen, Carlsbad, CA, USA) at RT for 20 min and then washed twice for 3 min in DEPC-treated water, immersed in 96% ethanol for 10 s and air-dried. In situ hybridization was carried out as described before16 using 35 pmoles/ml digoxigenin-labeled probes targeted to SncmtRNA (5' TGATTATGCTACCTTTGCACGGT) and the ASncmtRNAs (5' ACCGTGCAAAGGTAGCATAATCA) in hybridization solution. Washing and color development were carried out as described before14 (link),15 (link).

The mice used for histological analysis were different from those used in behavioral study. Six mice were selected randomly at each condition for extracting spinal cord. Tissue specimens were dissected from the spinal cord and fixed with Carnoy's fixative in 10% methanol overnight. The fixed tissues were embedded in paraffin and then cut at a thickness of 5 μm. The sections were mounted on silanized slides (Dako, Carpinteria, CA, USA) and deparaffinized with xylene and ethanol. To retrieve the antigen prior to immunohistochemical staining, the sections were pretreated in 10 mmol/L citrate buffer and autoclaved for 5 min at 121°C.
For the detection of MMP-2 and MMP-9, the sections were incubated for 1 h at room temperature with anti-human MMP-2 and anti-human MMP-9 antibodies (Santa Cruz Biotechnol., Dallas, TX, USA). Then, they were reacted with 3-amino-9-ethylcarbazole reagent supplied in the labeled streptavidin-biotin peroxidase kit (LSAB kit, Dako). The sections were faintly counterstained with hematoxylin [19 (link)].

Stomach sections (5 μm thick) from 5 animals per group were obtained using a microtome and then transferred onto silanized slides (Dako, Glostrup, Hovedstaden, Denmark). These sections underwent dewaxing and hydration procedures. Subsequently, a simple indirect blocking method was employed using Anti Peroxidase Peroxidase (APP), wherein the primary antibody targeted the antigen (protein) to be detected, while the secondary antibody facilitated binding to the APP complex. The slides were then incubated overnight at 4 °C with primary antibodies against NF-kB and TGF-β. Following thorough washing with distilled water, the slides were treated with a secondary antibody for 60 min. 3,3′-diaminobenzidine (DAB, Biocare Medical, Pacheco, CA, USA) was utilized as the chromogen, and the specimens were counterstained with hematoxylin. The samples were examined under an optical microscope (Olympus microscope, Tokyo, Japan) equipped with a camera (Nikon DS-Ri2).