The largest database of trusted experimental protocols

Ev depleted fbs

Manufactured by System Biosciences
Sourced in United States

EV-depleted FBS is a specialized fetal bovine serum (FBS) product that has been processed to remove extracellular vesicles (EVs). This product is designed for use in cell culture applications where the presence of EVs may not be desired.

Automatically generated - may contain errors

6 protocols using ev depleted fbs

1

Extracellular Vesicle Isolation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell lines and growth conditions are listed in Supplemental Table 1. For EV isolation, cells were cultured on 15 cm plates (10 × 106 cells/plate) in growth medium containing 2% EV-depleted FBS (System Biosciences) for 18–24 hours. Conditioned medium (CM) from the same number of cells was collected and cleared by sequential centrifugation at 2,000g for 10 minutes and 10,000g for 20 minutes, passed through 0.45 μm filters, and concentrated on Amicon Ultra-15 mL-30 K tubes (Sigma-Aldrich). Concentrated CM was then diluted 1:1 with PBS and centrifuged at 100,000g for 90 minutes. Crude EVs were resuspended in PBS and pelleted again at 100,000g for 60 minutes. EV pellets were either directly used for RNA isolation with the mirVana RNA kit (AM1561, Thermo Fisher Scientific),or resuspended in PBS for downstream analyses.
+ Open protocol
+ Expand
2

Isolation and Culture of Mouse Embryonic Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse embryonic fibroblasts (MEFs) were isolated from E12.5 littermate Ripk3+/+ or Ripk3–/– mice. HT29 cells were obtained from American Type Culture Centre. All cells were cultured in DMEM medium (4.5 g/L glucose) under 10% FBS and 1% penicillin‐streptomycin in a humidified chamber at 37°C under 5% CO2. Media was changed every 2–3 days and cells were passaged using 0.05% trypsin. EV‐depleted FBS (System Biosciences) was used for cells whose SEVs were used in experiments.
+ Open protocol
+ Expand
3

LPS-Induced Inflammation Model

Check if the same lab product or an alternative is used in the 5 most similar protocols
LPS from Escherichia coli O111:B4, miR-223–3p/miR-142–3p mimics, inhibitors, and respective controls were purchased from Sigma-Aldrich. Phosphate-buffered saline (PBS), fetal bovine serum (FBS), RPMI-1640 and DMEM were purchased from Gibco. EV-depleted FBS (System Biosciences). The canonical 3’ end adenylated hsa-miR-223–3p (5’ UGUCAGUUUGUCAAAUACCCCAAAA 3’) and 3’ end uridylated miR-223 (5’ UGUCAGUUUGUCAAAUACCCCAUUU 3’) were synthesized by Integrated DNA Technologies (IDT). IDT also synthesized all the adapters and primers used in this study, as described below. Lipofectamine® 3000 reagent, gentamicin, and protease inhibitor cocktail were purchased from Thermo Fisher Scientific. NLRP3 and CD68 antibodies were purchased from Abcam. CD11c, F4/80, Ly-6G/Ly-6C, and CD45 antibodies were ordered from BD Biosciences. E-cadherin, ASC, β-actin and CD40L antibodies were ordered from Cell Signaling Technology. K. pneu (strain from ATCC#43186) was provided by Dr. Dela Cruz at Yale University School of Medicine.
+ Open protocol
+ Expand
4

Extracellular Vesicle Isolation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
For EV isolation, A549 and H1299 adherent BCCs were seeded in 150 mm dishes with growth media supplemented with 10% EV-depleted FBS (System Biosciences) and CSCs were seeded in T75 low adherence flask with EV-free CSC media (serum-free DMEM-F12 medium; Gibco-Invitrogen) containing 0.4% Albumin Bovine Fraction V (Sigma-Aldrich), B-27 Supplement (Gibco-Invitrogen), 20 μg/mL EGF (PeproTech), and 10 μg/mL bFGF (PeproTech). The media was collected after 48 hours and centrifuged at 300 × g for 10 minutes at 4°C. The supernatant was transferred to a new polypropylene tube and centrifuged at 2,000 × g for 20 minutes at 4°C. The supernatant then was filtered through a 0.22 μm polyethersulfone membrane filter (Corning Incorporated) and transferred to a polyallomer ultracentrifuge tube and centrifuged at 10,000 × g for 30 minutes at 4°C (Beckman Coultier Optima Max Ultra). The supernatant was then transferred to a new polyallomer ultracentrifuge tube and centrifuged at 100,000 × g for 70 minutes at 4°C (Beckman Coultier Optima Max Ultra). The pellet was then suspended in 1X PBS, and the ultracentrifugation step was repeated to obtain an EV pellet that was suspended in 200 μL of sucrose buffer (5% sucrose, 50 mmol/L Tris, and 2 mmol/L MgCl).
+ Open protocol
+ Expand
5

Exosome Isolation from HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasma exosome isolation was performed using the ExoQuick exosome precipitation kit (SBI System Biosciences, Mountain View, CA, USA) according to the manufacturer’s protocol [26 (link), 27 (link)]. HepG2 cell lines constantly expressing CrebH were seeded in a 10 cm culture dish overnight and changed with fresh DMEM containing 10% EV-depleted FBS (SBI System Biosciences) for 48 h. The culture medium was centrifuged at 1000 × g for 5 min at 4 ℃ to eliminate suspended cells, filtered through a 0.22 μm syringe filter, and transferred to a Macrosep 100 KD filter system (PALL Laboratory, MA, USA) to enrich the particles with 30–90 nm molecular size. The exosomes contained in the enriched particles were isolated using ExoQuick-TC exosome precipitation solution (SBI System Biosciences). The exosome pellet was resuspended in 100 μL filtered-PBS and stored at − 80 ℃.
+ Open protocol
+ Expand
6

Hyaluronic Acid-Based Theranostic Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hyaluronic acid (HA, Mw = 4.8 kDa), 3-(diethylamino)propylamine (DEAP), N-hydroxysuccinimide (NHS), N,N’-dicyclohexylcarbodiimide (DCC), triethylamine (TEA), deoxycholic acid (DOCA), 4-dimethylaminopyridine (DMAP), pyridine, dimethyl sulfoxide (DMSO), sodium tetraborate, adipic acid dihydrazide (ADH), doxorubicin hydrochloride (DOX), paraformaldehyde, heparin, and Triton X-100, 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Chlorin e6 (Ce6) was purchased from Frontier Scientific Inc (Logan, UT, USA). RPMI-1640 medium, DMEM medium, fetal bovine serum (FBS), phosphate buffered saline (PBS), ethylene diamine tetra-acetic acid (EDTA), penicillin, trypsin, and streptomycin were purchased from Welgene Inc (Seoul, Korea). EV-depleted FBS was purchased from System Biosciences Inc. (Palo Alto, CA, USA). Cell Counting Kit-8 (CCK-8) was purchased from Dojindo Molecular Technologies Inc. (Santa Clara, CA, USA). Wheat Germ Agglutinin Alexa Fluor® 488 Conjugate (WGA-Alexa Fluor® 488), fluorescein isothiocyanate (FITC) were purchased from Life Technologies (Carlsbad, CA, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!