sRNAs were detected using LNA probes by Exiqon (Woburn, MA). Samples were vacuum fixed using 4% paraformaldehyde, and submitted to a histology lab (A.I. DuPont Hospital for Children) for paraffin embedding. We followed published protocols for the prehybridization, hybridization, and post-hybridization steps23 (link). For the detection step, fluorescent in situ hybridization was carried out using anti-Digoxigenin Fab fragment (Sigma-Aldrich cat# 11214667001) and donkey anti-sheep IgG (H + L) AF647 (Thermo Fisher Scientific cat# A-21448) antibody combination. We used a Zeiss LSM 880 multiphoton confocal microscope for the final imaging process with an excitation of 745 nm and EC Plan-Neofluar 40×/1.30 oil DIC objective (University of Delaware Bioimaging Center). Probe sequences are listed in Supplementary Data 11 .
Lna probe
Manufactured by Qiagen
Sourced in Denmark, Germany, United States
LNA probes are synthetic nucleic acid analogues that can be used in various molecular biology applications. They have increased thermal stability and binding affinity compared to standard DNA or RNA probes, allowing for improved specificity and sensitivity in detection and quantification of target sequences.
Automatically generated - may contain errors
Lab products found in correlation
Lsm 710 confocal microscope, by Zeiss (6 mentions)
Exiqon hybridization buffer, by Qiagen (2 mentions)
Anti digoxigenin hrp conjugate, by PerkinElmer (2 mentions)
Anti fluorescein hrp conjugate, by PerkinElmer (2 mentions)
Streptavidin hrp conjugate, by PerkinElmer (2 mentions)
Tsa cy3 and fluorescein kit, by PerkinElmer (2 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (2 mentions)
Mircury lna detection probe, by Qiagen (2 mentions)
Hybond n membrane, by Cytiva (2 mentions)
Pcr4 topo, by Thermo Fisher Scientific (2 mentions)
Superfrost plus slides, by Avantor (2 mentions)
Cryostat, by Leica (2 mentions)
Lsm 880 multiphoton confocal microscope, by Zeiss (1 mentions)
Miscript system, by Qiagen (1 mentions)
Sybr green 1 master mix, by Roche (1 mentions)
Mircury lna microrna pcr system, by Qiagen (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Glutaraldehyde, by Thermo Fisher Scientific (1 mentions)
Acetic anhydride, by Merck Group (1 mentions)
Triethanolamine, by Merck Group (1 mentions)
48 protocols using lna probe
1
Detection of Small RNA Molecules via FISH
2
Detecting Small RNAs via FISH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small RNAs were detected using LNA probes (Exiqon). Samples were vacuum fixed using 4% paraformaldehyde and processed by the A.I. DuPont Hospital for Children histology laboratory for paraffin embedding. Protocols for the prehybridization, hybridization, post-hybridization, and detection steps were as previously described (Javelle and Timmermans 2012 (link)). For FISH of DCL5 mRNA, digoxigenin-labeled probes were detected with sheep anti-digoxigenin antibodies (1/500) from Sigma-Aldrich (cat# 11214667001), and then with donkey anti-sheep antibodies conjugated to AlexaFluor647 (1/1000) from Thermo Fisher Scientific (cat# A-21448). Confocal images were taken with a Zeiss LSM880 microscope (Delaware Bioimaging Center) using a C-Apochromat 40X (NA = 1.3) oil immersion objective lens. FISH images were taken under 633 nm excitation and 649–758 nm emission wavelengths.
3
In Situ Hybridization of miR-34a in Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ hybridization (ISH) was performed using miR-34a 5’-DIG-labeled LNA™ probes (Exiqon, Vedbaek, Denmark) according to the manufacturer's protocol. The sequence of the detection probe for human mature miR-34a was 5’ ACAACCAGCTAAGACACTGCCA 3’. TMAs composed of intratumoral tissues from 296 patients were prepared as follows: the TMAs were (1) acetylated with 0.25% acetic anhydride after the sections were dewaxed and rehydrated; (2) prehybridized in Exiqon hybridization buffer (Exiqon, Vedbæk, Denmark) at 55°C for 60 min; (3) incubated with 40 μl of a 1:600 dilution of the corresponding 5’-DIG-labeled LNA™ miRNA probe; (4) washed twice with SSC buffer at 60°C for a minimum of 20 min; (5) treated with digoxigenin (DIG) blocking reagent (Invitrogen); (6) incubated with anti-DIG alkaline phosphatase conjugated antibody (Invitrogen) at 4°C for 24 h; and (7) washed twice and counterstained slightly with Mayer's hematoxylin.
4
In situ hybridization of mtr-miR171h
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The In situ hybridization was carried out as described previously [[30 (link)]]. Before embedding the roots and nodules into paraffin they were fixed under vacuum using fixative (4% paraformaldehyde in PBS, pH7). LNA probes against mtr-miR171h were custom designed by Exiqon.
5
Quantifying Parasite-Derived miRNAs in Host Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Analysis of miRNA levels in ultracentrifugation fractions was carried out using the miScript system (Qiagen) with unmodified DNA probes identical to the full-length parasite miRNA (Life Sciences): miR-100: 5′-AACCCGTAGATCCGAACTTGTGT-3′, miR-71: 5′-TGAAAGACATGGGTAGTGAGAC-3′, let-7: 5′-TGAGGTAGTAGGTTGTATAGTT-3′ and miR-60: 5′-TATTATGCACATTTTCTGGTTCA-3′. For analysis of parasite-derived miRNA levels in host cells, qRT–PCR was carried out using the miRCURY LNA microRNA PCR system (Exiqon) and LNA probes were custom-designed by Exiqon to minimize cross hybridization with mouse sequences, and efficiency of probes was measured between 90 and 100% (data not shown). Analysis of mouse gene expression levels was carried out using the Sybr green I master mix (Roche), with the following primers: gapdh_F: 5′-CATGGCCTTCCGTGTTCCTA-3′, gapdh_R: 5′-GCGGCACGTCAGATCCA-3′ Dusp1_F: 5′-GTGCCTGACAGTGCAGAATC-3′, Dusp1_R: 5′-CACTGCCCAGGTACAGGAAG-3′, Il33R_F: 5′-AGACCTGTTACCTGGGCAAG-3′, Il33R_R: 5′-CACCTGTCTTCTGCTATTCTGG-3′. Data were collected on a Light Cycler 480 System (Roche) following temperature profiles recommended by each manufacturer. The delta Ct method was used for quantification as described in ref. 11 (link) using GAPDH as the normalizer. Data were analysed using one-way analysis of variance (ANOVA) followed by Tukey’s post test and variance within groups assessed by Brown Forsythe test.
6
In Situ Hybridization of Fetal Tissues
7
Northern Blotting for miRNA Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the mirVana miRNA isolation kit (Ambion) according to the manufacturer’s instructions. Northern blotting was carried out using DIG-labeled LNA Probes (from EXIQON) as described previously [30 (link)]. RNA-containing membranes were washed with DIG-WASH buffer followed by incubation with CSPD (Roche) at 37°C for 10 min. Membranes were exposed to X-ray film and developed. Membranes were reprobed with DIG-labelled U6 probe (Exiqon, Product No. 99002–15) as a loading control.
8
Quantifying Gene Expression in ARPE-19 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ARPE-19 cells cultured for either 4 days or 4 months were used for total RNA and miRNA extraction using the RNeasy Protect Mini Kit (Qiagen) and the mirVana miRNA isolation kit (Thermo Fisher Scientific), respectively. Total RNA (2 μg) was reverse transcribed using the high-capacity cDNA archive kit (Thermo Fisher Scientific). The universal cDNA synthesis kit (Exiqon, Woburn, MA) was used for cDNA synthesis from miRNA. Five microliters of cDNA was used as a template for PCR, and each PCR reaction (20 μl) was performed on the ViiA™ 7 Real-Time PCR System using various TaqMan® (Thermo Fisher Scientific) or LNA probes (Exiqon; Table 1 ). The manufacturer’s default thermal cycling conditions were followed (40 cycles of 1 s at 95 °C and 20 s at 60 °C). GAPDH or RNU1A1 were used as the reference gene for mRNA or miRNA, respectively. The results were expressed as n-fold induction or inhibition in gene expression relative to endogenous control calculated using the ΔΔCT method.
9
Detection of Exogenous antimiR-145 in FFPE Mouse Lung
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FFPE blocks of mouse lung were cut into sections 5 μm thick, and ISH was used to detect distribution of exogenously administered antimiR-145. Custom DIG-labeled LNA probes (Exiqon) and ISH optimization kits were used according to the manufacturer’s instructions (Exiqon, #90-007). The LNA double-DIG-labeled antimir-145 probe was diluted to 60 nM (antimiR-145 and nontargeting oligonucleotides). Anti-DIG alkaline phosphatase (AP) antibody (#11093274910, Sigma-Aldrich, St. Louis, MO, USA) was used to visualize antimiR-145 (Figure 1 B). Slides were counterstained with Nuclear Fast Red prior to mounting coverslips.
10
LNA Probes for Bacterial Endosymbionts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The LNA probes used were specific in sequence for specific bacterial endosymbionts. The LNA probes were supplied by Exiqon A/S. The LNA probe sequences for different endosymbionts are given in the Table 2 . The concentration of probes used for all the endosymbionts was 10 nmoles per mL.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!