Sh nc
Sh-NC is a laboratory equipment product offered by Merck Group. It serves as a core function within the research and development process. Additional details about its intended use or application are not available.
Lab products found in correlation
12 protocols using sh nc
Manipulating CHRNA5 Expression in HCC
Overexpression and Knockdown Protocols for miR-485-5p and Regulatory Genes
To overexpress FOXM1 or FUS, the human FOXM1 or FUS cDNA sequence was cloned into pcDNA3.1 vector (Thermo Fisher Scientific, Waltman, MA, USA). The empty vector was used as the NC. The transfection of pcDNA3.1 vector or miRNA mimics was performed using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions.
Stable sh-NEAT1 cell line
Targeted Silencing of Key Oncogenic Pathways
To transiently target the expressions of EZH2, or LSD1, two distinct siRNAs for each specific target gene were purchased from Dharmacon (Lafayette, CO, USA) and transfected into 143B or SW1353 cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). siRNA targeting no known human or mouse genes (si‐NC) was used in parallel.
Knockdown of lncRNA PVT1 and p53 in Glioblastoma
Lentivirus harboring short hairpin RNA (shRNA) against lncRNA PVT1 (sh-PVT1), sh-p53 or sh-NC (Sigma-Aldrich) was titrated to 109 TU/mL. U373 cells were seeded in a 6-well plate at 2 × 105 cells/well and cultured for 24 h. U373 cells were infected with lentivirus for 72 h and cultured at least 14 days in medium containing 4 μg/mL puromycin. Cells resistant to puromycin were cultured for 9 days in medium containing 2 μg/mL puromycin and further cultured in puromycin-free medium to collect U373 cells with stable knockdown of lncRNA PVT1 or p53.
Nude mice were injected with 2 × 106 U373 cells that had been transfected with plasmids of shRNA-p53, shRNA-PVT1, or both at the armpit of upper limb. The diameter of tumor was measured twice every 8 days. Thirty two days later, mice were euthanized, after which tumor volume and weight were assessed.
Overexpression and Knockdown of MALAT1, LIN28A, and Nox4
Establishment of Stable MELK and FOXM1 Cell Lines
Specific shRNAs targeting MELK (shMELK#1 and shMELK#2) or FOXM1 (shFOXM1#1 and shFOXM1#2) and a scramble shRNA (shNC) were obtained from Sigma-Aldrich. The indicated sequences were described in
Lentiviral System for SLC9A3-AS1 Depletion
Silencing DIAPH3 via siRNA and shRNA
In order to construct stable DIAPH3 knockdown cell lines, sh-NC and sh-DIAPH3 lentivirus (derived from si-DIAPH3–1) were bought from Genechem company (Shanghai, China). The cells successfully transfected with sh-NC/sh-DIAPH3 lentivirus were screened using 5ug/ml puromycin (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for one week. The two pairs of oligonucleotides of sh-DIAPH3 were exhibited as follows: sh-DIAPH3:
F:
5′-CCGGCGTGTCAGAATAGCTAAAGAACTCGAGTTCTTTAGCTATTCTGACACGTTTTTG −3′.
R:
5′-AATTCAAAAACGTGTCAGAATAGCTAAAGAACTCGAGTTCTTTAGCTATTCTGACACG-3′.
Lentiviral Knockdown of ENaCα in Epithelial Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!