Fx96 thermocycler

NucleoZOL (Macherey‐Nagel) was used to perform total RNA extraction according to the manufacturer's recommendations. The First‐Strand cDNA Synthesis Kit (GE Healthcare, Chalfont St Giles, UK) was used to synthesize cDNA from 2 μg of total RNA, according to the manufacturer's instructions. The RT reaction mixture was diluted 1:4 and used as a cDNA template for qPCR. TaqMan quantitative PCR was carried out on a FX96 Thermocycler (Bio‐Rad). The PCR mixture contained TaqMan mix (Roche), 200 nM of primers (see Table S2 for their sequence), Universal Probe Library probe (100 μM, ThermoFisher Scientific) for the gene of interest (TaqMan Gene Expression Assays [Primers/probe], Life technologies), and 50 ng/μg of cDNA template. Reactions were performed in triplicate with the following program: 95°C 10 min, followed with 40 cycles of 95°C for 10 s, 59°C for 30 s. The relative amount of mRNA was calculated using the comparative Ct (ΔΔCT) method, following data normalization against GAPDH housekeeping gene.

Total RNAs were prepared using NucleoZOL (Macherey-Nagel) according to manufacturer’s recommendations. RNAs were reverse transcribed using a First-Strand cDNA Synthesis Kit (GE Healthcare) following the manufacturer’s instructions. Synthesis of cDNA was performed using a Maxima First cDNA Synthesis Kit (ThermoFisher Scientific). cDNA was used as a template for qPCR run, and mixed with primers (200 nM) for the gene of interest and SYBR™ Green PCR Master Mix (ThermoFisher Scientific). qPCR analyses were carried out with the FX96 Thermocycler (Biorad, Hercules, USA). Relative mRNA levels were determmined using the Comparative Ct (2^-ΔΔCT) method. mRNA levels of TBP, a housekeeping gene was used for normalization. Sequences of primers are as follows: TBP Fwd: CCCATGACTCCCATGACC, Rev.: TTACAACCAAGATTCACTGTGG; IL-8 Fwd: AGACAGCAGAGCACACAAGC, Rev.: ATGGTTCCTTCCGGTGGT; IL1α Fwd: GGTTGAGTTTAAGCCAATCCA, Rev.: TGCTGACCTAGGCTTGATGA.

Total RNAs were extracted using NucleoZOL (Macherey-Nagel) according to the manufacturer’s instructions. RNAs were reverse transcribed with First-Strand cDNA Synthesis Kit (GE Healthcare) following the manufacturer’s recommendations. TaqMan real-time quantitative PCR was then run with PCR mixture containing TaqMan mix (Roche), 200 nM of primers, Universal Probe Library probe (100 µM, ThermoFisher Scientific), and cDNA template. Reactions were performed in triplicate on a FX96 Thermocycler (Bio-Rad). The comparative Ct (ΔΔCT) method and normalization with GAPDH housekeeping gene were used to calculate the relative amount of mRNA. Sequences of primers are as follows: CALB1:Sens 5′-aagatccgttcggtacagctt-3′, Anti-sens 5′-ctgaaggatctgtgcgagaa-3′; CALB2:Sens 5′-tcatttcctttttgtttttctcg-3′, Anti-sens 5′-gcgatcttcacattttacgaca-3′; NFATc1: Sens 5′-ggtcagttttcgcttccatc-3′, Anti-sens 5′-ccaaggtcattttcgtggag-3′; GAPDH: Sens 5′-agccacatcgctcagacac-3′, Anti-sens 5′-gcccaatacgaccaaatcc-3′.