Thrombin (T4648), all chemicals were purchased from Sigma-Aldrich Corp. (St. Louis, MO), unless otherwise indicated. Transfection was done with Lipofectamine 2000 (Invitrogen). Ni-NTA beads were purchased from Clontech (635660). Anti-MAVS (Cell signaling, #3993), anti-IRF3 (Santa Cruz, sc-9082), anti-Flag (Sigma, F3165), anti-HA (Sigma, H9658), anti-GAPDH (Santa Cruz, sc-25778), anti-TBK1 (Santa Cruz, sc-52957; Cell signaling, #3504), anti-IKKε (Cell signaling, #2690S), anti-NEMO (Cell signaling, #2686S), anti-His (cw00c28), anti-IκBα (Cell signaling, #4814), anti-p-IRF3 (Epitomics, 2562–1), anti-p-TBK1 (Abcam, ab109272), anti-p-IκBα (Cell signaling, #2859), anti-p-IKKα/β (Cell signaling, #2078), anti-IKKα (Cell signaling, #2682), anti-IKKβ (Cell signaling, #2370), anti-NAP1 (Proteintech, 15042-1-AP), anti-TANK (Bioworld, BS2231), anti-SINTBAD (Cell signaling, #8605) antibodies were purchased as indicated. Antisera against viperion and p54/56 were generated by immunizing mice with the full length recombinant protein produced in E. coli, at Beijing Biotop Biotechnology, China.
Anti p tbk1
Manufactured by Abcam
Sourced in United Kingdom
Anti-p-TBK1 is a primary antibody that recognizes the phosphorylated form of the protein TBK1 (TANK-binding kinase 1). TBK1 is a serine/threonine protein kinase that plays a role in innate immune signaling and the regulation of gene expression.
Automatically generated - may contain errors
Lab products found in correlation
Anti pirf3, by Abcam (3 mentions)
Anti flag, by Merck Group (2 mentions)
Anti tbk1, by Abcam (2 mentions)
Anti irf3, by Abcam (2 mentions)
Anti gapdh, by Abcam (2 mentions)
Anti β actin, by Proteintech (2 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Thrombin, by Merck Group (1 mentions)
Anti ikkα, by Cell Signaling Technology (1 mentions)
Anti ikkβ, by Cell Signaling Technology (1 mentions)
Anti p ikkα β, by Cell Signaling Technology (1 mentions)
Anti gapdh, by Santa Cruz Biotechnology (1 mentions)
Anti p iκbα, by Cell Signaling Technology (1 mentions)
Ni nta beads, by Takara Bio (1 mentions)
Anti mavs, by Cell Signaling Technology (1 mentions)
Anti tbk1, by Santa Cruz Biotechnology (1 mentions)
Anti ikkε, by Cell Signaling Technology (1 mentions)
Anti nemo, by Cell Signaling Technology (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Anti irf3, by Santa Cruz Biotechnology (1 mentions)
5 protocols using anti p tbk1
1
Cellular Signaling Pathway Profiling
2
Antibody Validation for Western Blot and Immunofluorescence
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-NF-κB, anti-IRF3, anti-TBK1, anti-IFN-β, anti-GAPDH, anti-pNF-κB, anti-pTBk1, anti-pIRF3 and anti-DDDDK for WB and immunofluorescence (IF) assays were purchased from Abcam (Abcam, Cambridge, UK). Anti-HA and anti-Myc for WB and immunofluorescence (IF) assays were purchased from Thermo Fisher (ThermoFisher, Waltham, MA, USA). Anti-J-2 for IF assays were purchased from Scicons (Scicons, Szirák, Hungary). Secondary antibodies labeled with Alexa Fluor 488, Alexa Fluor 555, Alexa Fluor 594 or Alexa Fluor 647 for the IF assay were purchased from Abcam (Abcam, Cambridge, UK). Goat anti-mouse IgG H&L (HRP) and goat anti-rabbit IgG H&L were purchased from Abcam (Abcam, Cambridge, UK) and used in the WB assays.
3
Protein Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total proteins were extracted using cell lysis buffer (BioFeng, Changsha, Hunan, China). After the protein concentrations were determined by BCA kits, the protein samples were extracted and separated by 10% SDS-PAGE gel and then transferred to a PVDF membrane (Millipore, USA). The membrane was then blocked with 5% skimmed milk and incubated overnight, using the following main detection antibodies at 4°C: anti-GAPDH (1 : 1,000; Abcam), anti-Histon-H3 (1 : 1,000; Abcam), anti-Hsp60 (1 : 1,000; Abcam), anti-cGAS (1 : 1,000; Abcam), anti-STING (1 : 1,000; Abcam), anti-pSTING (1 : 1,000; Abcam), anti-TBK1 (1 : 1,000; Abcam), anti-pTBK1 (1 : 1,000; Abcam), anti-IRF3 (1 : 1,000; Abcam), anti-pIRF3 (1 : 1,000; Abcam), anti-PD-L1 (1 : 1,000; Abcam), anti-CD9 (1 : 1,000; Abcam), anti-TSG101 (1 : 1,000; Abcam), anti-Alix (1 : 1,000; Abcam), anti-Hsp90 (1 : 1,000; Abcam), or anti-β-actin (1 : 5,000; Proteintech). We washed 3 times with TBS-T, and the membranes were cultured with the secondary antibody at 24°C for 1 hr. The western blots were pictured using an ECL Reagent (Pierce, USA), and the density was verified using ImageJ software (NIH, USA).
4
Antibodies and Nucleic Acid Probes for Immunoblotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510) (1:3000), HRP-conjugated mouse anti-FLAG (Sigma, A8592)(1:1000), mouse anti-FLAG (Sungene, KM8002)(1:2000), anti-GFP (Sungene, KM8009)(1:2000) anti-β-Actin (KM9001)(1:2000), anti-Tubulin (KM9003), anti-GAPDH(KM9002), anti-HA (COVANCE, MMS-101R)(1:2000), anti-Ubiquitin (sc-8017)(1:500), anti-Ubiquitin K63-specific linkage (Millipore 05–1308)(1:500), rabbit anti-TBK1(Abcam, 96328–11), anti-p-TBK1(Abcam, 109272), anti-IRF3 (sc-9082)(1:1000), anti-p-IRF3 (Cell Singling Technologies, 4947S)(1:1000), anti-IκBα (sc-371)(1:1000), anti-p-IκBα (Cell Singling Technologies, 9246L)(1:1000), anti-USP49 (proteintech,18066-1-AP), anti-mouse MITA and anti-human MITA (Cell Singling Technologies,13647) (proteintech, 19851-1-AP ) were purchased from the indicated manufactures. ISD45, DNA90, and HSV120 were previously described [44 (link), 45 (link), 72 (link), 73 (link)]. ISD45: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; DNA90: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; HSV120: 5’-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3’.
5
Immunoblotting Analysis of Cellular Signaling Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed using RIPA reagent (Pierce, Thermo Scientific) supplemented with a protease inhibitor cocktail (Sigma-Aldrich). Protein concentrations were measured using the Pierce BCA Protein Assay Kit (Thermo Scientific), and the cell lysates were denatured with loading buffer. For immunoblot analysis, immunoprecipitates or whole-cell lysates were loaded and separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), and the proteins were transferred onto nitrocellulose membranes (Millipore) for immunoblot analysis as described previously51 (link). The following antibodies were used for immunoblot analysis: Anti-STING (1:1000, #13647), anti-TBK1 (1:1000, #3504), anti-p-IRF3 (1:1000, #4947), anti-IRF3 (1:1000, #4302), anti-p-STAT1 (1:1000, #9167), anti-cGAS (1:1000, #31659), and anti-streptavidin-HRP (1:1000, #3999) were purchased from Cell Signaling Technology. Anti-NMT1 (1:2000, ab186123), anti-ICP5 (1:3000, ab6508), anti-LC3B (1:2000, ab192890), and anti-p-TBK1 (1:1000, ab109272) were purchased from Abcam. Anti-Myc (1:5000, M4439) and anti-Flag (1:5000, F1804) antibodies were purchased from Sigma. Anti-β-actin (1:20,000, 66009-I-Ig) and anti-ARF1(1:1000, 20226-1-AP) were purchased from Proteintech. Anti-HA (1:2000, TA180128) was purchased from Origene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!