Fusion sl imager

For western blot analysis, the cellular extracts were solubilized in 3× Laemmli buffer consisting of 1% SDS and boiled for 5 min at 95 °C. Equal protein amounts (30–80 μg) were separated on SDS–polyacrylamide gel electrophoresis (12.5–15% gels) and transferred to nitrocellulose membranes. Antibody detection was accomplished using the enhanced chemiluminescence method (Thermo Fisher Scientific, Darmstadt, Germany) and developed either with the Fusion SL Imager (Vilber Lourmat, Eberhardzell, Germany) or the Curix60 processor (Agfa healthcare, Bonn, Germany). The following antibodies were used in 3% milk/TBS–Tween (0.1%): anti-mFas (1:1000, Santa Cruz Biotechnology, Dallas, TX, USA), anti-actin (1:40,000, MP Biomedicals, Eschwege, Germany), anti-tubulin (Bio-Rad, Munich, Germany), anti-E-cadherin (BD Transduction laboratories, Heidelberg, Germany), anti-hFas, anti-p65, anti-phospho-p65, anti-IκBα, anti-phospho-IκBα, anti-cleaved caspase-3 and anti-Bcl-x_L (Cell Signaling, Leiden, The Netherlands).

Cells were lysed in Triton Lysis Buffer (150 mM NaCl, 25 mM Tris pH 7,4, 1% Triton X-100 supplemented with cOmplete EDTA-free protease inhibitor cocktail) or RIPA (150 mM NaCl, 50 mM Tris pH 8, 1% NP40, 0.5% NaDoc, 0.1% SDS, supplemented with cOmplete EDTA-free protease inhibitor cocktail) as indicated. Cell lysates were denatured in 4X LDS/100 mM DTT and resolved on 4 to 12% Bris-Tris or 3 to 8% Tris Acetate SDS-PAGE gels under reducing conditions and transferred to a polyvinylidene difluoride membrane (PVDF, 0.45 μM, Thermo Fisher Scientific) or Millipore Immobilon FL for near-infrared fluorescence detection by LI-COR Clx. Membranes were blocked in 5% (w/v) nonfat dried skimmed milk powder in PBST (PBS, 0.1% Tween-20) for 1 h at room temperature (RT). Membranes were then probed with the appropriate primary antibodies in blocking buffer overnight at 4 °C. Detection was performed by incubating membranes with the appropriate horseradish peroxidase (HRP)-conjugated or IRDye secondary antibodies in blocking buffer at RT for 1 h. Enhanced chemiluminescence (ECL) (Thermo Fisher Scientific) was used for anti-ubiquitin western blots, and images were acquired on a FUSION-SL imager (Vilber Lourmat, France). Alternatively, anti-GST blots were visualized on a LI-COR Clx (46 (link)).

For analysis of DNA binding, electrophoretic mobility shift assay was used. The respective SPRTN proteins were incubated in 30 uL reactions (10 mM Tris-HCl pH 7.5, 0.2 mM DTT, 5 uM ZnSo4) with 0.25 uM fluorescently labeled ssDNA (6-FAM-ssODN 5’GCGCGCCCATTGATACTAAATTCAAGGATGACTTATTTC). To generate a dsDNA 6-FAM-ODN, the above oligo was annealed to a reverse complement oligo (GAAATAAGTCATCCTTGAATTTAGTATCAATGGGCGCGC). After a 30 min incubation at 20°C, protein-DNA complexes were separated on 1.5% Agarose gel and visualised by FUSION-SL imager (Vilber, Germany).