Takara pcr amplification kit

For ssrA gene positive samples, Bartonella citrate synthase (gltA) gene amplification was further performed. DNA amplification was performed according to the manufacture’s protocols of TaKaRa PCR Amplification Kit (Takara Bio Inc., Japan) in 20 μL mixtures containing 2 μL 10 × PCR buffer, 1.6 μL dNTP mix, 0.1 μL Taq, 13.5 μL double-distilled H₂O, 0.4 μL (10 μmol/L) of each primer (BhCS781.p: GGGG ACCAGCTCATGGTGG; BhCS1137.n: AATGCAAAAAGAACAGTAAACA [33 (link)]), and 2 μL of DNA template. gltA amplification was performed under the following conditions: one cycle for 5 min at 94 °C; 35 cycles for 30 s at 94 °C, 30 s at 55 °C, and 60 s at 72 °C; and a final extension for 10 min at 72 °C. Next, PCR products were identified by 1.5% agarose gel electrophoresis, and then sent to Shanghai BioGerm Medical Technology Co., Ltd (Shanghai, China) for sequencing.

The 3′-UTR of FGFR1 mRNA, which contained the predicted miR-198 binding site based on bioinformatical analysis using TargetScan, starBase and miRmap databases, was amplified by PCR using the Takara PCR Amplification Kit (Takara, Dalian, China). The Quick Mutagenesis Stratagene kit (Stratagene, La Jolla, CA) was used to create mutant 3′-UTR of EGFR1 mRNA. The PCR products were then enzymatically digested and cloned into the psiCHECK-2 reporter vector (Promega, U.S.A.). Cells (0.5 × 10⁵) were seeded in 24-well plates and cultured for 24 h. Reporter plasmids (200 ng psiCHECK-2-FGFR1-wild or psiCHECK-2-FGFR1-mut) and 100 nmol/l miR-198 mimics were co-transfected into SGC7901 cells mediated by Lipofectamine 2000 (Invitrogen). After 48 h, the cells were lysed and reporter activity was determined using a Dual Luciferase Reporter Assay Kit (Promega, Madison, WI, U.S.A.), according to the manufacturer’s instructions.

The genotyping of MeV was carried out as described previously^{35 (link)}. In brief, a region of 676 nt near the C-terminus of the MeV N gene was amplified using the SuperScript™ III One-Step RT-PCR System with Platinum™ Taq High Fidelity DNA Polymerase (Invitrogen, Carlsbad, CA, USA). A 1075-bp region in the gG gene of HSV-1 was amplified with genotype-specific primers (HSV gG-F: 5′-GCTTTGTTTGCCGCTGTTTC-3′ and HSV gG-R: 5′-AAGTCGTGTGCTGTTTCTCC-3′) using the TaKaRa PCR Amplification Kit (TaKaRa) with the following conditions: one cycle of 94 °C for 5 min and 35 cycles of 94 °C for 45 s, 58 °C for 45 s and 72 °C for 70 s followed by one cycle of 72 °C for 7 min. The sequencing of the PCR products was performed at Sangon Biotech (Shanghai, China).

The 3′-untranslated region (3′-UTR) of CCNB1 mRNA, which contained the predicted miR-144 binding site, was amplified by PCR using the Takara PCR Amplification Kit (Takara, Dalian, China). The following PCR primers were used for cloning 3′-UTR of CCNB1 mRNA (Forward: AAGGCTGTGGCAAAGGTGTAAC; Reverse: TCCCCAGGTAAACCAAAAGGAGT). The Quick Mutagenesis Stratagene kit (Stratagene, La Jolla, CA) was used to create mutant 3′-UTR of CCNB1 mRNA. The PCR products were then enzymatically digested and cloned into the pGL3-CCNB1-3′-UTR vector (Promega, USA). Cells (5 × 10⁴) were seeded in 24-well plates and cultured for 24 h. Reporter plasmids (200 ng the pGL3-CCNB1-3′-UTR or pGL3-CCNB1-3′-UTR-mut, 1 ng pRL-TK renilla plasmid, Promega) and 100 nmol/L miR-144 mimics were co-transfected into HEK293 cells mediated by Lipofectamine 2000 (Invitrogen). After 48 h, the cells were lysed and reporter activity was determined using a Dual Luciferase Reporter Assay Kit (Promega, Madison, WI, USA), according to the manufacturer’s instructions.

Total RNA was extracted from cells and tissue using Trizol reagent (Invitrogen, Grand Island, NY, USA). Reverse transcription was performed with 2 μg of total RNA using the RevertAidTM First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA). The resulting cDNA was subsequently amplified using the TakaRa PCR amplification Kit (TakaRa, Kyoto, Japan). The parameters for PCR were as follows: one denaturing cycle at 94°C for 3 min, 35 amplification cycles of 94°C for 30 s, 55°C for 20 s and 72°C for 30 s, one extension cycle of 72°C for 10 min. All products were electrophoresed on 1.5% standard agarose gels that were subsequently stained with ethidium bromide and images were obtained with a gel imaging system (Lingcheng Biological Science and Technology Co Ltd, Shanghai, China).
For real-time PCR, Bestar® SybrGreen qPCR Mastermix (DBI® Bioscience, Ludwigshafen, Germany) was used according to the manufacturer's instructions. Sequences of real-time PCR primers were designed by Primer Express software v 3.0 (Applied Biosystems, Foster City, CA, USA) and were analyzed with BLAST in GenBank database to exclude homology with other genes. The mRNA level was normalized to GAPDH mRNA expression in each sample individually. All primers for reverse transcription PCR and real-time PCR are shown in supplementary material 1.

Sanger sequencing was used to detect variations in all exons and exon-intron boundaries in genes PAX2 and PAX6. Primers sequences were designed by online program (http://bioinfo.ut.ee/primer3-0.4.0/) (Supplementary Table 4). Polymerase chain reaction (PCR) amplification (35 cycles, 10 seconds at 98 °C, 15 seconds at 60 °C and 2 minutes at 72 °C) was carried out on DNA samples from two affected family members (III:8 and IV:3) with TaKaRa PCR Amplification Kit (Takara Bio Inc., Nojihigashi, Japan). PCR products were then purified and sequenced using an ABI 3730XL Genetic Sequencer in both directions (Applied Biosystems, Foster City, CA, US). Exons with detected variations were next sequenced in all family members to evaluate whether they represent disease-associated mutations.