Sybr master mix

The total RNA of different cells was prepared with Trizol reagent as the manufacturer’s described. The reverse transcription was performed with TIANScript RT Kit. Primer sequences used for detection of HBX were TGTGAAGCTTATGGCTGCTAGGC and TGTGGAATTCTTAGGCAGAGGTG. Primers for HBsAg were CATCTTCTTGTTGGTTCTTCTG and TTAGGGTTT AAATGTATACCC. Primers for β-actin amplificaiton were GGCATCGTGAT GGACTCCG and GCTGGAAGGTGGACAGCGA. The UitraTaq enzyme PCR kit was used for PCR reaction and amplification condition was 94 °C for 5 min, followed with 94 °C for 40 s, 67 °C for 30 s, 72 for 1 min for 30 cycles and a final extension at 72 for 10 min each. The PCR products were subjected to electrophoresis in 1 % agarose gel and visualized by ethidiun bromide staining. The real-time PCR primers for DR4, DR5 AND GAPDH were CTGAGCAACGCAGAC TCGCTGTCCAC and TCAAAGGACACGGCAGAGCCTGTGCCA, GGGAGCCGCTCATGAGGAAGTT GG and GGCAAGTCTCTCTCCCAGCGTCTC, TGGAA GGACTCATGACCACA and TTCAGCTCAGGGATGACCTT, respectively. The real-time PCR was performed with a SYBR master mix (Toyobo, Japan), and amplification conditions were as follows: 94 °C for 3 min, and followed by 40 cycles of 95 °C for 30s, 60 °C for 30 s, 72 for 30s. The relative mRNA expression levels of DR4 and DR5 were normalized based on the GAPDH in each group.

Total RNA was extracted from heart tissues using the TRIzol reagent (Invitrogen). cDNAs were synthesized from total RNA by using PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa) and Q-PCR was performed on the QuantStudio 6 Flex System (Thermo Fisher Scientific) with the SYBR master mix (Toyobo) following the manufacturer’s instructions. The primers for the tested mouse genes were purchased from JIELI Biology (Shanghai, China) and their sequences are as follows: Il1β, 5′-GGTGTGTGACGTTCCCATTAGAC-3′ (forward), 5′-CATGGAGAATATCACTTGTTGGTTGA-3′ (reverse); Il6, 5′-TAGTCCTTCCTACCCCAATTTCC-3′ (forward), 5′-TTGGTCCTTAGCCACTCCTTC-3′ (reverse); Fn1, 5′-ATGTGGACCCCTCCTGATAGT’ (forward), 5′-GCCCAGTGATTTCAGCAAAGG-3′ (reverse); Col1α1, 5′-GCTCCTCTTAGGGGCCACT-3′ (forward), 5′-CCACGTCTCACCATTGGGG-3′ (reverse); Ccl5, 5′- GCTGCTTTGCCTACCTCTCC-3′ (forward), 5′-TCGAGTGACAAACACGACTGC-3′ (reverse); Cxcl10, 5′-CCAAGTGCTGCCGTCATTTTC-3′ (forward), 5′-GGCTCGCAGGGATGATTTCAA-3′ (reverse); Gapdh, 5′-AGGTCGGTGTGAACGGATTTG-3′ (forward), 5′-TGTAGACCATGTAGTTGAGGTCA-3′ (reverse).

To quantify the transcripts of Fh3GT2 and Fh3GT1, specific primers were designed for quantitative real-time PCR (qRT-PCR) assays which were carried out in 10-μl reaction volumes with an ABI StepOne Plus Real-Time PCR System (USA). The total volume contained 5 μl SYBR Master Mix (TOYOBO, Japan), 0.5 μM of each primer, and 1 μl of cDNA templates. The cycling conditions were as follows: 95°C for 5 min, 45 cycles of 95°C for 10 s, 60°C for 10 s, and 72°C for 20 s. 18S rRNA was used as the internal reference and the gene expression levels were calculated with the formula 2^−ΔΔCт (Livak and Schmittgen, 2001 (link)).

In order to study the spatial and temporal expression patterns of FhDFR genes in F. hybrida, specific quantitative real-time PCR primers were designed. Transcript levels were analyzed using SYBR Master Mix (TOYOBO, Japan) and a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). All biological replicates were analyzed in triplicate. PCR parameters were set as previously reported (Li et al., 2016 (link)). Briefly, a total volume of 10 μl of reaction mixture containing 5 μl of 2 × Master Mix, 0.5 μM of each primer, and 1 μl cDNA were analyzed using the following cycling conditions: 95°C for 60 s, followed by 40 cycles of 95°C for 5 s and 60°C for 60 s. Real-time PCR reactions were normalized to the Ct values for freesia 18S rRNA. The relative expression levels of the target genes were calculated using the formula 2^-ΔΔCT (Livak and Schmittgen, 2001 (link)).

Total RNA was extracted from cells and tissues utilizing the reagent of TRIzol (Invitrogen, Carlsbad, CA, USA) conforming to the protocol of the manufacturer. RNA samples with a 260/280 nm ratio >1.8 were considered quality RNA specimens. A total volume of 20 µl was used for RT reactions, and these reactions were carried out utilizing a kit of PrimeScript RT reagent (Takara) conforming to the protocol of the manufacturer. For quantitative PCR (qPCR), 2 µl of diluted RT product was blended with 10 µl of 2× SYBR Master Mix (Toyobo), 2 µl primers (10 µM) (Supplementary Table S1), and 6 µl of nuclease-free water in a final volume of 20 µl conforming to the instructions of the manufacturer. Further, amplification was accomplished with the system of iQ5 qPCR (Bio-Rad) with annealing at 60 °C for 30 s and denaturation at 95 °C for 30 s for 40 cycles. qPCR was executed in triplicate, containing nontemplate controls. β-Actin was utilized for normalization of expression, and 2^−ΔΔCT values were normalized to the β-actin levels.