Olaparib

Manufactured by Promega

Olaparib is a lab equipment product developed by Promega. It is a PARP inhibitor that blocks the activity of the PARP enzyme, which is involved in DNA repair. Olaparib can be used in research applications to study DNA damage response and DNA repair mechanisms.

Automatically generated - may contain errors

Lab products found in correlation

Fitc annexin 5 kit, by BioLegend (1 mentions) Celltiter glo reagent, by Promega (1 mentions) Cisplatin, by Abcam (1 mentions) Facscanto 10 flow cytometer, by BD (1 mentions) Niraparib, by Selleck Chemicals (1 mentions) Veliparib, by Selleck Chemicals (1 mentions) Olaparib, by Selleck Chemicals (1 mentions) Lipofectamine, by Thermo Fisher Scientific (1 mentions) Clariostar, by BMG Labtech (1 mentions) Celltiter glo luminescent cell viability assay, by Promega (1 mentions) Olaparib, by Chemietek (1 mentions)

2 protocols using olaparib

Evaluating PARP Inhibitor Cytotoxicity and Apoptosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Olaparib, veliparib, and niraparib were obtained from Selleck Chemicals and cisplatin was obtained from Biovision. To test cellular viability after Olaparib treatment, cells were seeded in 96-well plates at a density of 2000 cells per well, treated with the indicated doses of Olaparib for 3 days, and assessed using CellTiter-Glo reagent (Promega, G7572) per manufacturer’s instructions. Clonogenic survival assays were performed by seeding cells in 6-well plates; after 72 h (Olaparib) or 24 h (cisplatin) of treatment at the indicated concentrations, media was changed and colonies were allowed to form for 2 weeks. Cells were fixed with a solution of 10% methanol + 10% acetic acid and stained using crystal violet (2% solution, Aqua Solutions). For apoptosis assays, cells were treated with Olaparib (5 μM) for 3 days, prepared for flow cytometry using the FITC Annexin V kit (Biolegend, 640906) and quantified using a BD FACSCanto 10 flow cytometer operated by BD FACSDiva 8.0.1 software.

Clements K.E., Schleicher E.M., Thakar T., Hale A., Dhoonmoon A., Tolman N.J., Sharma A., Liang X., Imamura Kawasawa Y., Nicolae C.M., Wang H.G., De S, & Moldovan G.L. (2020). Identification of regulators of poly-ADP-ribose polymerase inhibitor response through complementary CRISPR knockout and activation screens. Nature Communications, 11, 6118.

+ Open protocol

+ Expand

PARP Inhibitor Sensitivity in 53BP1 Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols

To measure the sensitivity of cells expressing 53BP1 F1553R to PARP inhibition by olaparib, 53BP1^−/− MEFs (kindly provided by Dr. Penny Jeggo, University of Sussex) were transduced with the retroviral pOZ vector, empty or containing the cDNA of 53BP1, with or without the F1553R mutation, and lacking the BRCT domains. Selected clones were transfected twice in 24-h intervals using Lipofectamine (Invitrogen) with a control siRNA (AAGCCGGUAUGCCGGUUAAGU) or an siRNA directed against BRCA1 (CAGCAGUUUAUUGCUCAUUGA). The cells were seeded into 96-well plates 24 h after the second transfection. The day after plating, olaparib (ChemieTek) was serially diluted in media that was added to the wells. Five days later, olaparib was removed and the cells were incubated in drug-free media for 72 h. The number of viable cells in culture was then determined from the ATP-based CellTiter-Glo luminescent cell viability assay (Promega) using a luminescence microplate reader (CLARIOstar, BMG Labtech). For each olaparib concentration, data were plotted as a percentage of cell survival in drug-free media.

Botuyan M.V., Cui G., Drané P., Oliveira C., Detappe A., Brault M.E., Parnandi N., Chaubey S., Thompson J.R., Bragantini B., Zhao D., Chapman J.R., Chowdhury D, & Mer G. (2018). Mechanism of 53BP1 activity regulation by RNA-binding TIRR and a designer protein. Nature structural & molecular biology, 25(7), 591-600.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!