Abi quantstudio 3 real time pcr system

The purified RNA samples were reverse-transcribed using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China) following the manufacturer's protocol. In the 4,286 upregulated genes with a length over 750 bp, 16 unigenes were selected for the qRT-PCR assay. Gene specific qRT-PCR primers (18–22 bp) were designed using Premier 5.0 software (Premier Biosoft International, Palo Alto, CA). qRT-PCR was performed using TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (Takara Bio Inc., Shiga, Japan) in an ABI Quantstudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). PCR conditions were 30 s at 95°C, followed by 40 cycles of heating at 95°C for 5 s and annealing at 60°C for 34 s. Three replicates were performed, and the amplification specificity were checked by melting curves. The relative expression level of each gene, namely the fold change (FC) of gene expression between treated samples and the control sample, was calculated using 2^−ΔΔCt, and the beta-actin gene from the Poa transcriptome served as the reference gene.

Total RNA extraction was carried out using TRIzol Reagent (Invitrogen, USA) according to the manufacturer’s instructions. Amplifications were then performed with the different primers. The quality and quantity of the RNA obtained were subjected to spectrophotometric analysis using a bio-photometer (Thermo Scientific™ NanoDrop8000). The RNA was then reversed-transcribed into complementary DNA (cDNA) using a Reverse Transcription kit (Takara Bio Inc., Japan). Quantitative real-time polymerase chain reaction (qPCR) was performed with the SYBR Green PCR reagent kit (Roche, Germany) on an ABI QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primer sequences are listed in Table 1. All values were normalized to GAPDH.
Table 1

Primer sequences used for quantitative real-time PCR analysis

Gene	Forward sequence (5′-3′)	Reward sequence (5′-3′)
GAPDH	GGGTCGGTGTGAACGGATTTGG	GCCGTGGGTAGAGTCATACTGGAAC
C-Myc	AACCCGACAGTCACGACGATG	GCTCTGCTGTTGCTGGTGATAG
Runx2	GAGATTTGTAGGCCGGAGCG	CCCTAAATCACTGAGGCGGT
BMP2	TGCTCAGCTTCCATCACGAAG	TCTGGAGCTCTGCAGATGTGA

Total RNA was extracted using a TRIzol reagent in accordance with the manufacturer’s instructions and reversely transcribed. RT-qPCR was also performed using TB Green Premix Ex Taq II (Takara Bio, Otsu, Japan) in accordance with the manufacturer’s instructions. All experiments were performed in triplicate with ABI QuantStudio 3 Real-time PCR System (Applied Biosystems, MA, USA). The primer sequences are summarised in Supplementary Table 4. Differences in cDNA input were normalized to the ACTB expression levels. FEV positivity was defined in accordance with a previous report (17 (link)).

Total RNA was isolated using TRIZOL reagent (Invitrogen) according to the manufacturer’s instructions. And cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (G592, abm, Canada) following the manufacturer’s protocol. The mRNA levels were detected by SYBR Green real-time PCR Master Mix (G891, abm, Canada) and performed on ABI QuantStudio 3 Real-Time PCR System (Applied Biosystems). The mRNA expression was normalized by the expression of GAPDH and relative expression levels were calculated using the 2^-ΔΔCT method in cell and tissue lysates. Primers are shown in Supplementary Table S3.