Oligotex dt30

Total RNA of cauline leaves and inflorescences of the homozygous BnAHAS1^544T transgenic Arabidopsis plants was extracted using plant RNA extraction kit (E.Z.N.A.^®Plant RNA Kit, OMEGA), and the first strand cDNA was synthesized using Oligotex-dT30 (TaKaRa). RT-PCR was performed to determine the expression of BnAHAS1^544T, with the housekeeping gene Ubiquitin-conjugating enzyme 21 (UBC21, At5g25760) as the internal reference. A primer pair A1-forward (5′_ATCCCCTCTACCCATTTCC_3′) and A1-reverse (5′_TTGTCGGTTTTTTCAGGGG_3′) was used for amplification of BnAHAS1^544T and a primer pair UBC21-forward (5′_CTGCGACTCAGGGAATCTTCTAA_3′) and UBC21-reverse (5′_TTGTGCCATTGAATTGAACCC_3′) was used for amplification of UBC21.

Total RNA was prepared using ISOGEN (Nippon Gene), and poly(A)⁺-RNA was purified using Oligotex-dT30 (Takara Bio). Liver poly(A)⁺-RNAs from nonhibernating and hibernating chipmunks were fractionated by electrophoresis on a 1% agarose gel containing 2.2 M formaldehyde, and then transferred to a nylon filter. Hybridization was carried out using chipmunk cDNAs as probes as described^{8 (link)}.

Bruguiera gymnorrhiza, Kandelia obovata, and Rhizophora apiculata were collected from Dongzhai Harbor Nature Reserve, Hainan, China, and C. brachiata was collected from Baiyun Mount, Guangzhou, China. For each species, total RNA was separately isolated from fresh young leaves and roots of the same individual using a modified CTAB method (Fu et al., 2004 (link)) and quantified by NanoDrop (Thermo Fisher Scientific Inc., Waltham, MA, USA). The leaves and roots were rinsed thoroughly in running water to remove the dust and surface-sterilized with 75% ethanol solution before RNA extraction to avoid exogenous contamination. Then, equal amounts of total RNA from the leaves and roots of a species were uniformly mixed and delivered to the Beijing Genome Institute (Shenzhen, China) for cDNA library construction and sequencing; mRNAs were extracted using Oligotex™-dT30 (TaKaRa, Dalian, China) and fragmented ultrasonically. The fragmented mRNAs were converted into double-stranded cDNAs using random primers and then adaptors were ligated to both ends. The purified cDNA libraries were sequenced using the GAII platform (Illumina Inc., San Diego, CA, USA) with a read length of 90 bp and insertion size of 200 bp. For comparison, raw reads of Ce. tagal were obtained from Yang et al. (2015b (link)) and processed as described above.

Total RNA was extracted using TRIzol^® reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. An aliquot (100 µg) of the resulting total RNA was polyA purified using Oligotex™-dT30 (Takara Bio Inc., Shiga, Japan), again according to the manufacturer’s instructions. An aliquot (2 μL) of polyA equivalent to 0.5 ng RNA was then diluted into 6 mL of diethyl pyrocarbonate (DEPC)-treated water and used as the template in an RT reaction using TaqMan™ Reverse Transcription Reagents (Applied Biosystems, Waltham, MA, USA) according to the manufacturer’s protocol. The resulting products were employed for real-time quantitative PCR using the Power SYBR™ Green PCR Master Mix (Applied Biosystems, Waltham, MA, USA) in the StepOnePlus™ (Applied Biosystems, Waltham, MA, USA) system. Target RNA expression levels were estimated using the relative standard curve method. The standard curve was generated using serial dilutions of pAcGFP1-C1-based plasmids containing the respective target sequences. Again, the primers realtime_GFP sense and realtime_GFP antisense used in this study are listed in Table 1.