Orf clone

Human ACE2 lentiviral cDNA ORF Clone (C-GFPSpark tag, Human, HG10108-ACGLN) mammalian expression plasmids were purchased from Sino Biological. sgRNA against ACE2 (sg-ACE2: ATGAGCACCATCTACAGTAC) were synthesized and cloned into the pLenti-V2 vector. pLV-linker-GFP control vector was cloned from ACE2 lentiviral cDNA ORF Clone as the NC (Fig. 1O). The lentivirus was packaged in HEK293T cells with psPAX2 and pMD2.G, condensed by ultra-centrifugation. Knock-out (KO) cells were selected with puromycin (2 μg/mL) for 14 days, sub-cloned to form single colonies, and validated by Western blotting assay to verify the loss of ACE2 expression. full-ACE2-GFP, dACE2-GFP, or linker-GFP expressed A549/U-251 MG/H1299/HEK-293T cells were sorted by fluorescence-activated cell sorting (FACS) (Fig. S1D).

All cloning was performed by Gibson Assembly. The pSK-mNG-cam1:kanMX6 construct to make the mNG-Cam1 strain was made by cloning the cam1 5’ flank, mNG and cam1 coding sequence into the NotI/BamHI restriction sites in pSK. Then the sequences encoding kan^R and cam1 3’ flank were cloned into BamHI/KpnI. ank1⁺ was amplified from cDNA and cloned into pREP1 and pET15b at the NdeI/BamHI.
The cam1⁺ coding sequence was cloned into the KpnI/XhoI sites of pFastBac-Dual (Thermo Fisher Scientific; 10712024). The cam2⁺ coding sequence was then cloned into the BamHI/SacI sites. In addition, the sequence encoding Myo1(1–964)-FLAG₃ was synthesized in a gene block (Integrated DNA Technologies) and codon optimized for expression in Sf9 cells and cloned into the BamHI/SacI sites in pFastBac-Dual. The ank1⁺ sequence was cloned in the KpnI/XhoI sites.
pcDNA-OSTF1-mCherry were made by amplifying OSTF1 cDNA from an ORF clone (Sino Biological; cat# HG20537-U) and cloned into the BamHI/EcoRI sites in pcDNA. mCherry was cloned into the EcoRI site of pcDNA.