Total RNA was extracted with Trelief RNAprep FastPure Tissue&Cell Kit (Tsingke). First‐strand cDNA was synthesized using the TransScript Uni All‐in‐One First‐Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech) with 1 µg of RNA as the template for each reaction. mRNA levels were quantified under optimized conditions with Hieff qPCR SYBR Green Master Mix (Yeasen) according to the manufacturer's instructions. Rps18 and RPS18 were used as the reference genes for mouse and human samples, respectively.
Trelief rnaprep fastpure tissue cell kit
Manufactured by Tsingke
Sourced in China
The Trelief RNAprep FastPure Tissue&Cell Kit is a laboratory equipment product designed for the rapid and efficient extraction of high-quality RNA from various tissue and cell samples. The kit utilizes a proprietary technology to ensure the reliable isolation of RNA while minimizing the risk of contamination or degradation.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green mix, by Wuhan Servicebio Technology (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Transscript uni all in one first strand cdna synthesis supermix for qpcr, by Transgene (1 mentions)
Hieff qpcr sybr green master mix, by Yeasen (1 mentions)
Hieff qpcr sybr green master mix high rox plus, by Yeasen (1 mentions)
Hifair 3 1st strand cdna synthesis kit gdna digester plus, by Yeasen (1 mentions)
Gdna remover kit, by Toyobo (1 mentions)
Abi 7900 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
Revertra ace qpcr rt master mix, by Toyobo (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Abscript 2 cdna first strand synthesis kit, by ABclonal (1 mentions)
6 protocols using trelief rnaprep fastpure tissue cell kit
1
Quantitative Analysis of mRNA Levels
2
Quantitative Analysis of mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cultured cells was extracted using the Trelief ™ RNAprep FastPure Tissue &Cell Kit (Tsingke) and reverse transcribed into cDNA using a Hifair® III 1st Strand cDNA Synthesis Kit (gDNA digester plus) (Yeasen) according to the manufacturer's instructions. Subsequently, according to the manufacturer's protocol, quantitative real‐time polymerase chain reaction (qRT‐PCR) was performed with Hieff® qPCR SYBR Green Master Mix (High Rox Plus) (Yeasen). GAPDH was used as an internal reference gene for quantification of mRNA. The relative RNA level was calculated by using the 2−ΔΔCt method. The RT‐qPCR primers used in this study are as follows: TTI1, forward primer: AAGTCATGCTGCGGAACTCA, reverse primer: TGGGAACCACTGGGCTAATG; mTOR, forward primer: CCAGGCCGCATTGTCTCTAT, reverse primer: AGTCTCTAGCGCTGCCTTTC; ribosomal protein S6 kinase beta‐1 (S6K1), forward primer: CTGAGGACATGGCAGGAGTG, reverse primer: ACAATGTTCCATGCCAAGTTCA. EIF4EBP1, forward primer: CAAGGGATCTGCCCACCATT, reverse primer: AACTGTGACTCTTCACCGCC. All experiments were done three times.
3
Transcriptional analysis of Huh7.5 cells treated with EPS364
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Huh7.5 cells were treated with different concentrations of EPS364 (0, 0.8 or 1.2 mg/mL) for 5 h. The total RNA of the Huh7.5 cells was extracted using a Trelief™ RNAprep FastPure Tissue&Cell kit (Tsingke Biotechnology Co., Ltd., Beijing, China). RNA was reversely transcribed into cDNA using a ReverTra Ace qPCR RT Master Mix with a gDNA Remover kit (Toyobo Co., Ltd., Osaka, Japan). The PCR amplification was carried out using a SYBR® Green Realtime PCR Master Mix (Toyobo Co., Ltd., Osaka, Japan), and the transcriptional levels of different genes were detected by an ABI 7900 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The relative expression was calculated using the 2−∆∆Ct method. All primers are listed in Supplementary Materials Table S1 . All experiments were performed three times.
The interactions of the proteins were analyzed using the online software String 11.0 (https://string-db.org/ (accessed on 17 December 2020)).
The interactions of the proteins were analyzed using the online software String 11.0 (
4
RT-qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples of cells were collected by using TreliefTM RNAprep FastPure Tissue & Cell Kit purchased from TSINGKE Biological Technology. RNA samples were reverse transcribed into cDNA using PrimeScriptTM RT Master Mix (Perfect Real Time) from TaKaRa. cDNA samples were amplified and calculated by a LightCycler 480 II (Roche, Basel, Switzerland) system. The reaction was performed by the following process: 95 °C for 2 min, followed by 45 cycles at 95 °C for 15 s and 62 °C for 1 min. The sequence of interested gene primers is listed in Table 1 . All the Ct values were controlled to lower than 40, indicating the efficiency of gene amplification. All the RT-qPCR assays obeyed the MIQE guidelines [27 (link)].
5
Quantifying Gene Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells’ total RNA was extracted using TreliefTM RNAprep FastPure Tissue & Cell Kit (TSP413, Tsingke, Beijing, China). NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) was used for RNA purity and concentration detection. 1000 ng of the product was used for the subsequent reverse transcription process, which was then performed PCR by StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) with SYBR Green mix (Servicebio, Wuhan, China). With endogenous GAPDH as the control, all qPCR processes were repeated three times. The primers were obtained from TSINGKE, the primer sequences for qPCR were as follows: SCD1: Forward: 5′-TCT AGC TCC TAT ACC ACC ACC A-3′, Reverse: 3′-TCG TCT CCA ACT TAT CTC CTC C-5′, CYP19A1: Forward: 5′-TGG AAA TGC TGA ACC CGA TAC-3′, Reverse: 3′-AAT TCC CAT GCA GTA GCC AGG-3′, GAPDH: forward: 5′-CGT GGA AGG ACT CAT GAC CA-3′, reverse: 5′-GCC ATC ACG CCA CAG TTT C-3′.
6
Comprehensive RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TreliefTM-RNAprep-FastPure Tissue & Cell Kit (TSP413, TSINGKE) was employed for RNA extraction. The reverse transcription process was performed using the ABScript II cDNA First-Strand Synthesis Kit (RK20400, ABclonal). The subsequent qRT-PCR was conducted using the SYBR Green mix (G3326, Servicebio). The primers for the qPCR were obtained from TSINGKE, and the primer sequences are presented in Table 2 .
Primer sequences used for qRT-PCR
| Name | Sequence (5’ ~ 3’) | Length |
|---|---|---|
| GPX4 (Forward Primer) | GAGGCAAGACCGAAGTAAACTAC | 23 |
| GPX4 (Reverse Primer) | CCGAACTGGTTACACGGGAA | 20 |
| NRF2 (Forward Primer) | TCAGCGACGGAAAGAGTATGA | 21 |
| NRF2 (Reverse Primer) | CCACTGGTTTCTGACTGGATGT | 22 |
| SLC7A11 (Forward Primer) | TCTCCAAAGGAGGTTACCTGC | 21 |
| SLC7A11 (Reverse Primer) | AGACTCCCCTCAGTAAAGTGAC | 22 |
| FTH1 (Forward Primer) | CCCCCATTTGTGTGACTTCAT | 21 |
| FTH1 (Reverse Primer) | GCCCGAGGCTTAGCTTTCATT | 21 |
| SCD1 (Forward Primer) | TCTAGCTCCTATACCACCACCA | 22 |
| SCD1 (Reverse Primer) | TCGTCTCCAACTTATCTCCTCC | 22 |
| CBS (Forward Primer) | GGCCAAGTGTGAGTTCTTCAA | 21 |
| CBS (Reverse Primer) | GGCTCGATAATCGTGTCCCC | 20 |
| FTMT (Forward Primer) | TGGAGTGTGCTCTACTCTTGG | 21 |
| FTMT (Reverse Primer) | ACGTGGTCACCTAGTTCTTTGA | 22 |
| MTOR (Forward Primer) | ATGCTTGGAACCGGACCTG | 19 |
| MTOR (Reverse Primer) | TCTTGACTCATCTCTCGGAGTT | 22 |
| GPER1 (Forward Primer) | CACCAGCAGTACGTGATCGG | 20 |
| GPER1 (Reverse Primer) | CATCTTCTCGCGGAAGCTGAT | 21 |
| GAPDH (Forward Primer) | GGAGCGAGATCCCTCCAAAAT | 21 |
| GAPDH (Reverse Primer) | GGCTGTTGTCATACTTCTCATGG | 23 |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!