Cell lines stably expressing Cas9 were generated by lentiviral transduction followed by selection in the presence of Blasticidin (Cambridge Bioscience) to ensure high Cas9 activity. K562 cells were transduced using eSpCas9(1.1)21 (link) (Addgene #71814), Cas9-TREX2 and Cas9-2A-TREX2 vectors to generate K562-eCas9, K562-Cas9-TREX2 and K562-Cas9-2A-TREX2 respectively. E14TG2a-Cas9 cells were generated by transducing E14TG2a cells with pKLV2-EF1aBsd2ACas9-W34 (link)(Addgene #67978).
Blasticidin
Manufactured by Cambridge Bioscience
Blasticidin is a laboratory-grade antibiotic used as a selection marker in cell culture applications. It inhibits protein synthesis, allowing for the identification and selection of transfected or transduced cells.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using blasticidin
1
Generating Cas9-Expressing Cell Lines
2
Conditional Degradation of CPSF73 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CPSF73 gene was tagged with a C-terminal FKBP degron by the MMEJ homology method described by Nabet et al. (2018) (link). CPSF73 homology arms were inserted into the plasmid pCRIS-PITChv2-dTAG-BSD (BRD4) according to the protocol provided by Nabet et al. The gRNA (GGCTGCACAGAGACTGTACG) was inserted into the Cas9 vector GW223-pX330A-sgX-sgPITCh. Both plasmids were a kind gift from the Mayer Lab. The plasmids were transfected into MRC5-VA cells using Lipofectamine 3000 (Invitrogen, ThermoFisher Scientific) and selected with 5ug/ml Blasticidin (Cambridge Bioscience). Single clones were isolated and the genomic DNA prepared using QuickExtract (Epicentre Technologies) and ExoSapIT (Applied Biosystems). The region surrounding the tag insertion site was amplified with primers ATTAGGACCGTGCTGCTGTC and CCTGTAACACCCACGAGGAC using Q5 polymerase (New England bioLabs). Clones with a PCR product of 3036 bp were expanded and analysed by Western blot using either antibodies to HA (ab 236632 Abcam Ltd) or CPSF73 (A301-090 Bethyl Laboratories Inc). Genomic DNA was sequenced to ensure correct insertion of the degradation tag. Homozygous clones were treated with dTAG-7 (Tocris, Bio-Techne Ltd.) at 250nM for 2h and the degradation of CPSF73 confirmed by Western blot.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!