Gel doc xr system

UBE2D1-ubiquitin thioester was prepared by incubating 25 μM UBE2D1, 0.2 μM UBE1 (MRC-PPU Reagents and Services, University of Dundee), and 2 μM DyLight 800 Maleimide fluorescently labelled ubiquitin (Ub-IR⁸⁰⁰) (Kumar et al, 2015 (link)) in reaction buffer (50 mM Tris pH 7.5, 25 μM ubiquitin, 3 mM ATP, 0.5 mM TCEP [all from Sigma-Aldrich], 5 mM MgCl₂, and 150 mM NaCl) for 20 min at 37°C. Reaction was stopped by addition of MLN4924 derivative, compound 1 (25 μM), which inhibits E1 (Brownell et al, 2010 (link); Pao et al, 2018 (link)) for 15 min at RT. Then, UBE2D1-ubiquitin conjugates were incubated with 100 nM RNF12 and 150 mM L-lysine in a buffer containing 50 mM Tris, pH 7.5, 150 mM NaCl, 0.5 mM TCEP, and 0.1% (vol/vol) NP40 at RT. Reaction was stopped by addition of non-reducing SDS loading buffer and samples were analysed via SDS–PAGE and in-gel fluorescence was measured with a Gel-Doc XR+ System (Bio-Rad). Gels were then stained with Coomassie (InstantBlue reagent; Abcam) and scanned in a Gel-Doc XR+ System (Bio-Rad).

Analysis of XBP1 splicing as a surrogate marker of IRE1α activation was performed as previously described^{67 (link)}. Briefly, first-strand cDNA was synthesized from the total RNA isolated from PC3 cells (Fig. 2f) or mouse livers (Figs. 4h and 5f) using SuperScript III reverse transcriptase (Invitrogen). Because activated IRE1α processes the XBP1 mRNA (XBP1u, 473 base pairs (bp)) to a shorter XBP1 mRNA that lacks a 26 bp fragment including the PstI restriction site (XBP1s, 447 bp), cDNA from the spliced form XBP1s is resistant to PstI, whereas that from the unprocessed form XBP1u is digested by PstI into 290 and 183 bp fragments. The cDNAs of XBP1u and XBP1s were amplified by PCR using the same primer set: 5′-AAACAGAGTAGCAGCGCAGACTGC-3′ and 5′- TCCTTCTGGGTAGACCTCTGGGAG -3′. The amplicons were digested by PstI, resolved on 2% agarose gels containing ethidium bromide, and then visualized using the Gel Doc XR + system (Bio-Rad). The 447 bp band represented the cDNA amplicon from the processed XBP1s, whereas both the 290 and 183 bp bands originated from the cDNA amplicon from the unprocessed XBP1u. The band density was quantified using the Gel Doc™ XR + System (Bio-Rad), and results are expressed as A.U.

According to the staining results, cytoplasm or ECM exhibiting brown granules were considered positive for TGF-β1. Based on the pigmentation intensity; no pigmentation, light yellow, yellow or brown, the positivity was scored as 0, 1, 2, or 3, respectively. Five different regions of each section were selected to calculate the average percentage of positive cells and the corresponding scores. Sections with <5% positive cells scored 0; 5–25% positive cells scored 1; 26–50% positive cells scored 2; 51–75% positive cells scored 3; and >75% positive cells scored 4. The two scores were then multiplied to determine the positivity of a sample, whereby 0–2 corresponds to (−), 3–4 to (+), 5–8 to (++) and 9–12 to (+++) (2 (link)). The results were examined by two individuals to reduce error and bias. For semi-quantitative PCR analysis the gel electrophoresis results were recorded using the Gel Doc XR System [Bio-Rad Laboratories (Canada) Ltd., Mississauga, ON, Canada] and the densitometry was analyzed using an automatic image analysis system (Gel Doc XR System) to calculate the relative contents of TGF-β1 mRNA (β-actin served as the internal reference). The following formula was used: TGF-β1 mRNA relative expression level = TGF-β1 band density/β-actin band density.

Yeast-secreted and IMAC purified gp120 was denatured for 5 min at 95° C, loaded on a NuPAGE Novex 3–8% Tris-Acetate gel (Life Scienes), and 150 V were applied for 1 h in MOPS buffer (Life Sciences). The gel was stained using GelCode Blue Stain Reagent (Pierce) and analyzed using a Gel Doc XR System (Bio-Rad). For Western blotting analyses of HIV spike protein variants, typically 20 μl of denatured and reduced crude culture supernatant were loaded and the gel was blotted for 1.5 h at 30 V on a 0.45 μm pore-size PVDF membrane (Life Sciences). The membrane was washed twice for 10 min in PBS, blocked for 1 h in PBS supplemented with 5% BSA and 0.1% v/v Tween 20, washed twice for 10 min in PBS supplemented with 0.05% v/v Tween 20 (PBST) and once in PBS. The washed membrane was incubated with 1 ml PBS containing 3% BSA, 0.1% v/v Tween 20 and 5 μl goat polyclonal anti-gp120 antibody HRP conjugate ab53840 (Abcam) for gp120 detection or 1 μl mouse monoclonal anti-His antibody HRP Conjugate 34460 (Qiagen) for His-tag detection while covered by a transparency. The membrane was then washed as before and incubated for 1 min with enhanced chemiluminescence substrate (Pierce) and analyzed using the Gel Doc XR System (Bio-Rad).

Strains were cultured for one day. Their mycelia were used as the DNA source. DNA was extracted using a Phytopure TM DNA Extraction Kit (GE Healthcare, Chicago, IL, USA) according to the manufacturer’s directions. Amplification of the ITS (Internal Transcribed Spacer) rDNA region was performed using PCR with the primer pair ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′ and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) [26 ]. All PCR amplifications were performed in 25 mL of reaction mixture, containing ±100 ng of DNA template, 0.25 mM of each primer, PCR buffer 1, dNTPmix 0.2 mmol L⁻¹, MgCl₂ 1.75 mmol L⁻¹, and 1 unit of Taq DNA polymerase. The reaction condition was set as follows: initial denaturation at 94 °C for 1 min, followed by 25 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min. Final elongation was completed at 72 °C for 10 min. PCR products were set in 1.5% agarose gel, stained with ethidium bromide, and examined by electrophoresis at 100 V for 30 min. The gel was visualized using the Gel Doc XR þ system (Bio-Rad, Hercules, CA, USA). PCR products were sent to First BASE for sequencing.

No-template (molecular-grade water) and positive controls were included in all cPCR assays. Products were separated on 1.5% agarose gel containing SYBR^TM Safe DNA Gel Stain (Invitrogen, Carlsbad, CA, USA) in TBE buffer and were visualised under UV light (Bio-Rad Gel Doc XR System, Bio-Rad Laboratories Pty Ltd., Gladesville, NSW 2111, Australia). Positive samples were identified by a band migrating at the expected product size. The identity of PCR products from positive controls, a random selection of samples and any sample giving a band at the expected size in the FeLV cPCR were confirmed using Sanger sequencing (Macrogen Inc., Geumcheon-gu, Seoul 08511, South Korea). Any DNA sample that gave a negative result on all viral PCRs was tested for feline glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by cPCR to confirm the presence of amplifiable genomic DNA and the absence of PCR inhibitors [14 (link)]. Samples that were negative for GAPDH were excluded from the analysis (lymphoma FFPE samples, n = 6; autologous FFPE controls, n = 3; lymphoma blood samples, n = 1; control lymph node FFPE samples, n = 3; total n = 13).