Hybridoma supernatant in batches of 400 mL were filtered using a 0.22 μm pore size bottle-top vacuum filter (Corning) to remove cell debris. Buffers were developed based on the manufacturer’s recommendations (Cytiva Protein G Sepharose 4 Affinity Chromatography Handbook). Supernatant was diluted 1:1 with binding buffer (20 mM H2NaO4P·H2O, pH 7.0). Protein G resin (2.5 mL, Cytiva Protein G SepharoseTM 4 Fast Flow) was added to a 1.0 × 10 cm Econo-Column (Bio-Rad) and washed twice with 10 mL of binding buffer. Supernatant/binding buffer solution was added to a Econo-Column Reservoir (Bio-Rad) attached to the Econo-Column and allowed to gravity flow through the resin. After flow-through was collected, the resin was washed twice with 10 mL of binding buffer to remove supernatant. To elute the bound mAbs, 6 mL of elution buffer (0.1 M glycine buffer, pH 2.5–3.0) was added to the column. Elution fractions were collected in 1-mL fractions and diluted 1:10 with neutralizing buffer (1 M TrisHCl, pH 9.0). mAb concentration was calculated using a Nanodrop spectrophotometer, and the top yields were selected and pooled. Purified mAbs were dialyzed using a Slide-A-Lyzer 10K (Fisher) over 48h at 4°C with two separate exchanges of PBS buffer.
Econo column
Manufactured by Bio-Rad
Sourced in United States
The Econo-Column is a versatile and durable chromatography column designed for a wide range of purification applications. It features a simple, easy-to-use design with a stable and corrosion-resistant construction.
Automatically generated - may contain errors
Lab products found in correlation
Ni nta agarose, by Qiagen (3 mentions)
Superdex 200 10 30 column, by GE Healthcare (2 mentions)
Ab119880, by Abcam (2 mentions)
Ab193473, by Abcam (2 mentions)
D lactose, by Merck Group (2 mentions)
Pfastbac, by Thermo Fisher Scientific (2 mentions)
Ni sepharose 6 fast flow beads, by GE Healthcare (2 mentions)
Retreiver 500, by Teledyne (2 mentions)
Fc204 fraction collector, by Gilson (2 mentions)
Sep pak c18 cartridge, by Waters Corporation (2 mentions)
Hitrap, by Cytiva (2 mentions)
Monoq 10 100 column, by GE Healthcare (1 mentions)
Sb 1200, by Eyela (1 mentions)
Fraction collector, by Gilson (1 mentions)
Sepharose cl 2b beads, by GE Healthcare (1 mentions)
G50 fine, by GE Healthcare (1 mentions)
Sepharose cl 2b, by Bio-Rad (1 mentions)
Ni nta purification system, by Thermo Fisher Scientific (1 mentions)
Vivaspin, by GE Healthcare (1 mentions)
Ultrafree mc filter, by Merck Group (1 mentions)
50 protocols using econo column
1
Protein G Purification of Monoclonal Antibodies
2
Recombinant Expression and Purification of CjRecR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli BL21 (DE3) cells containing the cjRecR-expression plasmid were grown in an LB medium at 37 °C. When the optical density of the culture at 600 nm reached 0.6, the culture was supplemented with isopropyl β-D-1-thiogalactopyranoside (1 mM) to induce cjRecR overexpression. The cells were further cultured at 37 °C for 3 h. The resultant cells were harvested using centrifugation and lysed using sonication in 50 mM Tris, pH 8.0, 200 mM NaCl, and 5 mM β-mercaptoethanol (βME).
The cjRecR protein was first purified using immobilized metal affinity chromatography. The cell lysate containing the hexahistidine-tagged cjRecR protein was incubated with Ni-NTA resin, and the resin was harvested using an Econo-Column (Bio-Rad, Hercules, CA, USA). The cjRecR protein was eluted from the resin using a solution containing 50–500 mM imidazole, 50 mM Tris, pH 8.0, 200 mM NaCl, and 5 mM βME. The eluted cjRecR protein was dialyzed against 20 mM Tris pH, 8.0, and 5 mM βME and then treated with thrombin to remove the hexahistidine tag. Subsequently, the untagged cjRecR protein was purified via anion exchange chromatography using a Mono Q 10/100 column (GE Healthcare, Chicago, IL, USA) with a NaCl gradient (0–500 mM) in 20 mM Tris, pH 8.0, and 5 mM βME.
cjRecO protein was produced in E. coli cells and purified by affinity and ion exchange chromatography as described previously [6 (link)].
The cjRecR protein was first purified using immobilized metal affinity chromatography. The cell lysate containing the hexahistidine-tagged cjRecR protein was incubated with Ni-NTA resin, and the resin was harvested using an Econo-Column (Bio-Rad, Hercules, CA, USA). The cjRecR protein was eluted from the resin using a solution containing 50–500 mM imidazole, 50 mM Tris, pH 8.0, 200 mM NaCl, and 5 mM βME. The eluted cjRecR protein was dialyzed against 20 mM Tris pH, 8.0, and 5 mM βME and then treated with thrombin to remove the hexahistidine tag. Subsequently, the untagged cjRecR protein was purified via anion exchange chromatography using a Mono Q 10/100 column (GE Healthcare, Chicago, IL, USA) with a NaCl gradient (0–500 mM) in 20 mM Tris, pH 8.0, and 5 mM βME.
cjRecO protein was produced in E. coli cells and purified by affinity and ion exchange chromatography as described previously [6 (link)].
3
Synthesis and Purification of HA-8mer Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HA-8mer was synthesized as previously described (Kanekiyo et al., 2013 (link); Weaver et al., 2016 (link)). Briefly, plasmids were transiently transfected into FreeStyle 293-F cells in FreeStyle 293 Expression Medium. After 5 days of culturing in conditions described above, cell culture supernatants collected by centrifugation and concentrated using a tangential flow filtration setup with a 30 kDa cutoff. In 100 mL aliquots, the concentrate was mixed with 2 mL of PBS-equilibrated Erythrina cristagalli lectin-immobilized resin (EY Laboratories) at 4°C and incubated overnight with gentle agitation. The resin was then loaded onto a 1.5 × 20 cm glass Econo-Column (Bio-Rad) and washed with five column-volumes of PBS by gravity flow. HA-8mer particles were eluted with two column-volumes of 0.2 M D-lactose (Sigma-Aldrich) in PBS and concentrated in a centrifugal concentrator with a 100 kDa cutoff. Size-exclusion FPLC was then performed using a Superdex 200 10/30 column (GE Healthcare) and purified HA-8mer was again concentrated as before.
Recombinant HPV16 L1 (Abcam ab119880) and recombinant HBsAg AD (Abcam ab193473) were reconstituted following the manufacturer’s guidelines. Nanoparticle formation of the expected size was confirmed by dynamic light scattering.
Recombinant HPV16 L1 (Abcam ab119880) and recombinant HBsAg AD (Abcam ab193473) were reconstituted following the manufacturer’s guidelines. Nanoparticle formation of the expected size was confirmed by dynamic light scattering.
4
Purification of Filovirus Glycoproteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Filovirus proteins were produced and purified as previously described (Keck et al., 2015 (link), Howell et al., 2016 (link)). Briefly, the coding regions of EBOV GPΔTM or SUDV GPΔTM were inserted into baculovirus transfer vectors (pFastBac, Invitrogen) and used to transfect Sf9 insect cells. The recombinant baculoviruses containing the GPΔTM were recovered from the supernatant and amplified in Sf9 cells. The final virus was used to infect Sf9 cells, and the protein was purified from the supernatant 3 dpi. The supernatant was concentrated and mixed with Ni Sepharose 6 Fast Flow beads (GE Life Sciences) overnight at 4°C. The next day, the beads were separated by centrifugation and packed into a Bio-Rad Econo column. The column was washed with PBS, 20% glycerol, 0.2% Tween 20, and 10 mM imidazole. Protein was eluted with the same buffer containing 500 mM imidazole and was dialyzed into PBS containing 10% glycerol, arginine, and glutamic acid. All proteins were analyzed by SDS-PAGE and western blot for purity, and protein concentrations were determined using the bicinchoninic acid (BCA) assay. Proteins were aliquoted and stored at −80°C for long-term storage.
5
Desalting and Purification of Pyridine Dinucleotides
6
Purification of Leu. lactis SBC001 Oligosaccharides
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligosaccharides produced by Leu. lactis SBC001 were purified as described in a previous study [17 (link)]. The culture supernatant was concentrated 10-fold at 60 °C using a rotary evaporator (SB-1200, EYELA, Miyagi, Japan), and the concentrate was loaded onto Bio-gel P2 resin (Bio-Rad Laboratories, Inc., Hercules, CA, USA) packed in a glass Econo-Column (1.5 × 120 cm, Bio-Rad Laboratories, Inc.). The elutes were collected using a fraction collector (Gilson Inc., Middleton, WI, USA) with a fraction volume of 5 mL per tube with a flow rate of 0.5 mL/min. The fractions were analyzed by thin-layer chromatography (TLC), and the oligosaccharide fractions were pooled and freeze-dried using a freeze dryer (SunilEyela, Seongnam, Korea). The freeze-dried powder was dissolved in distilled water at a concentration of 1% (w/v).
7
Purification of 6His-tagged erdR protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene encoding erdR (pp_1635) was cloned into pET16b in frame with a nucleotide sequence encoding a N-terminal 6His tag and used to transform Escherichia coli C41. Briefly, an overnight culture of C41 containing pET16b-erdR grown at 37 °C was used to inoculate 1 L of LB medium supplemented with 100 μg/mL ampicillin (initial OD600 of 0.1). The culture was incubated at 30 °C with continuous shaking until reaching an OD600 of ~0.5, then, induction was performed with 0.5 mM IPTG for 3 h. The pellet of the culture was later collected by centrifugation, washed once with 50 mM Tris-HCl buffer (pH 8) and then, resuspended in lysis buffer (50 mM Tris-HCl pH 8, 300 mM KCl, 10% glycerol, 10 mM imidazole, 0.5 mM PMSF and 2 mM β-mercaptoethanol). For cell disruption, the pellet was processed by Constant Cell Disruptor BT40/TS2/AA (Constant Systems Ltd.) (pressure: 1.35 kBar). Cellular debris were separated from the supernatant by centrifugation. Later, the supernatant was used for an affinity chromatography by Ni-NTA. To that end, resin and sample were incubated 1 h at 4 °C and then packet onto a column (Econo column, Bio Rad). The column was later washed with imidazole (10 and 30 mM), and finally, the protein (6His-ErdR) was eluted in buffer containing 50 mM Tris-HCl pH 8, 100 mM KCl, 10% glycerol, 200 mM imidazole and 2 mM β-mercaptoethanol.
8
Fractionation and Characterization of Extracellular Vesicles
9
Recombinant Protein Production and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant proteins were produced using the following primer sequences (CppA: cppA_pET-F: 5’- CCGGATCC AATGACTTTAATGGAAAATATTAC -3’ cppA_pET-R: 5’ CCGGATCC TTCATTTCGTAAACCATACTTC 3’, HVR: emm_pET-F: 5’- CCGGATCC AGGTTTTGCGAATCAAACAGAGGTTAAG -3’, emm_pET-R: 5’- CCGGATCC TAGCTCTCTTAAAATCTCTTCCTGCAACTTCC -3’, Aur: aur_pET-F: 5’- CGGGATCC GATTGATTCAAAAAATAAACC -3’ aur_pET-R: 5’- CGGGATCC TTACTCCACGCCTACTTCATTC) and the pET-19b overexpression system as previously described [49 (link)]. rCppA, rEmm 1.0 hypervariable region (HVR), rAur and the previously described rScpA fragment [49 (link)], truncated at amino acid 720 to prevent pro-peptide removal, were purified using the Ni-NTA purification system (Invitrogen) according to the manufacturer's instructions. Purified proteins were buffer-exchanged into PBS. Full-length rScpA was expressed following amplification from gDNA (scpA_pET-F: 5’- CCGGATCC AACCAAAACCCCACAAACTC-3’, scpA_pET-R: 5’- CCGGATCC TAGAGTGGCCCTCCAATAGC-3’), and purified from BL21 cell lysates by size exclusion chromatography using a 1 × 50 cm Econo-Column® (Bio-Rad) packed with Sephadex G-100 (Pharmacia). PBS fractions containing ScpA were identified by SDS-PAGE, pooled and concentrated using a 30,000 MWCO spin column (Vivaspin, GE Healthcare).
10
MHC-Peptide Complex Extraction Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!