Dna engine opticon 2

RNA was isolated using Tri Reagent (Molecular Research Center) as instructed by the manufacturer, from 3 × 10⁵ cells or from isolated mouse-enriched neurovascular fractions. For qRT-PCR analyses, total RNA was reverse transcribed with Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (Promega, Madison, Wisconsin, USA), and amplification was performed on a DNA Engine Opticon2 (MJ Research, St. Bruno, Canada) using B-R SYBER Green SuperMix (Quanta Biosciences, Beverly, Massachusetts, USA). Primer sequences are reported in Table 1.
The relative expression of each mRNA was calculated by the comparative threshold cycle method and normalized to β-actin mRNA expression.

One µg of total RNA for each sample was treated with DNase I (NIPPON GENE, Tokyo, Japan) prior to reverse transcription to cDNA using Multiscribe Reverse Transcriptase with random primers (ThermoFisher Scientific). qRT-PCR was performed with SsoAdvanced Universal SYBR Green Supermix (BIO-RAD, California, USA) using DNA Engine Opticon 2 (MJ Research, Quebec, Canada). Reactions were run in triplicate in three independent experiments. Data were normalized with the housekeeping gene β-ACTIN and were calculated by the 2-ΔΔCT method^{49 (link)}. Data were presented as means ± SD (1.0-fold as the control). The primer sequences were as follows: β-ACTIN forward 5′-AAACTGGAACGGTGAAGGTG-3′ and reverse AGAGAAGTGGGGTGGCTTTT3′, ACTA2 forward 5′-CTGTTCCAGCCATCCTTCAT-3′ and reverse 5′-GCTGGAAGGTGGACAGAGAG-3′, REG1A forward 5′-CTGGAATCCTGTGCTTGAGG-3′ and reverse 5′-GGTCTCCTACAAGTCCTGGG-3′, REG3A forward 5′-CCTCTGGAAACCTGGTGTCT-3′ and reverse 5′-CCACTCCCAACCTTCTCCAT-3′, DUOX2 forward 5′-GAGCCCTTCTTCAACTCCCT-3′ and reverse 5′-GGAGGACAGGCTCAGAAGTT-3′, and DUOXA2 forward 5′-GGTCTCCTACAAGTCCTGGG-3′ and reverse 5′-TTTACAGATCGCCCCAGGAG-3′.

Total RNA was isolated from freshly frozen visceral adipose tissues and OE33 cells using the Rneasy Lipid Tissue Mini Kit and the Rneasy Mini Kit (Qiagen), respectively, treated with DNase (TURBO-DNase-free, Life Technologies) and reverse transcribed using random primers (Promega) and M-MLV reverse transcriptase (Promega). mRNA levels were measured by Real-Time PCR (DNA Engine Opticon2, MJ Research) using SYBR Green PCR Master Mix (Life Technologies) and specific intron-spanning human primers, according to manufacturer's instructions. Values were calculated as the mean of triplicate measurements and levels were normalized to HMBS mRNA expression.

Quantitative real-time PCR was performed using DNA Engine Opticon-2 (MJ Research, Waltham, MA) and SYBR Green PCR Master Mix Kits (ABI, America). GAPDH was used as the reference gene. The primers of the selected genes are listed in Table 1. The PCR system consisted of 10 μl of SYBR Green PCR Master Mix, 2 μl of cDNA, 6 μl of double distilled water, and 2 μl of primer pairs (25 μmol/l forward and 25 μmol/l reverse) in a total volume of 20 μl. Forty cycles were performed, each cycle consisting of denaturation (94 °C, 15 s), annealing (54 °C, 30 s), and elongation (72 °C, 45 s) except for the first cycle in which denaturation was 95 °C for 15 min and the last cycle in which the elongation time was for 10 min. The number of cycles used for each gene was in the linear amplification range. All samples were measured in triplicate. The relative mRNA levels of target genes were determined using the relative standard curve method.Table 1

Primer sequences used for quantitative real-time PCR

Genes	Oligo	Primer sequence	Predicted size (bp)	Gene bank accession
HSL	Forward PrimerReverse Primer	5′-TGCCCAAGACAGAGCCAATG-3′5′-CCCAAGTAAGAAGTTGACGGTTGA-3′	209	NM_001128154
SCD	Forward PrimerReverse Primer	5′-GCTACAAGAGTGGCTGAGTTT-3′5′-AAGGCAGAGTTGTTGGTTTC-3′	185	NM_001009254
GAPDH	Forward PrimerReverse Primer	5′-GCAAGTTCCACGGCACAG-3′5′-GGTTCACGCCCATCACAA-3′	249	AJ431207

RNA extraction and cDNA synthesis were done as described before^{59 (link)}. Equal amount of RNA was used in cDNA synthesis. Quantitative PCRs were performed with TaqMan Universal Master mix with MJ Research DNA Engine Opticon2 or with QuantStudio-3 Real-Time PCR system. All TaqMan assays were purchased from Applied Biosystems. For semi-quantitative PCR the quality of cDNA was tested by GAPDH amplification (GF: 5′-GGCTGAGAACGGGAAGCTTGTCAT-3′ and GR: 5′-CAGCCTTCTCCATGGTGGTGAAGA-3′). PIR2 expression was analysed with the primers: FL-PIR2-F: 5′-ATGGGCTCAGCTGGTAGGC-3′ and FL-PIR2-R: 5′-GGTTGTGGATGGGTCGTGCT-3′. The amplified DNA fragments were analysed as described previously^{60 (link)}.