16s metagenomic sequencing library preparation guide

Total soil DNA was extracted from 0.3 g soil samples with the PowerSoil DNA extraction kit (MoBio Laboratories, Carlsbad, CA) as directed by the manufacturer’s instructions. PCR amplification was performed according to the Illumina 16S Metagenomic Sequencing Library preparation guide (Illumina) with slight modification, targeting the V4 region (primer 515f and 806r) of the bacterial 16S rRNA gene with index sequences and adapters. PCR involved initial denaturation at 95 °C for 2 min, followed by 30 cycles of denaturation at 95 °C for 20 s, annealing at 55 °C for 15 s, elongation at 72 °C for 5 min, and a final elongation at 72 °C for 10 min. Paired-end sequencing of the PCR amplicons involved the MiSeq 250-bp paired sequencing system (Illumina) according to the manufacturer’s instructions.

Sequencing of 16S rRNA was performed to determine the relative abundance of Lactobacillus spp. and to assess the shift in the presence and type of each bacterial species before and after LBP intake. Extracted DNA was used for PCR amplification. The amplicon (5 µL) of each participant was subjected to electrophoretic separation on a 1.5% agarose gel (Cosmogentech, Ltd., Seoul, Republic of Korea), and the product (~490 bp) was visualized under UV light (Daihan Scientific, Ltd., Wonju, Republic of Korea). A sequencing library with subsequent steps (purification, sample indexing, sample quantification, and pooling) was prepared according to the Illumina 16S metagenomic sequencing library preparation guide (Illumina, San Diego, CA, USA). The V4–V5 region of the bacterial 16S rRNA gene was amplified using 16S rRNA gene sequencing using the following primers: a forward primer in the V4 region (CCA GCM GCC GCG GTA ATW C) and a reverse primer in the V5 region (CC GTC AAT TYY TTT RAG TTT). The amplified sequencing library was purified using Agencourt^® AMPure XP beads (Beckman Coulter, Brea, CA, USA), and the quality of the library was assessed using a 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA). The library pool was sequenced with 250 bp paired-end reads on the MiSeq platform (Illumina, San Diego, CA, USA) using the MiSeq reagent kit V2 (Illumina, San Diego, CA, USA).

Bacterial DNA was extracted from the intestinal contents of non-challenged pigs in the third animal experiment using the All Prep PowerViral DNA/RNA kit (QIAGEN, Tokyo, Japan) according to the manufacturer’s instructions, followed by measurement of the DNA concentration and purity using a NanoDrop (Thermo Scientific Scientific, Tokyo, Japan). The extracted DNA was kept at − 20 ℃ until used for 16 S rRNA PCR. The V3–V4 region of the bacterial 16 S rRNA gene was amplified by following the Illumina 16 S Metagenomic Sequencing Library Preparation guide. Final DNA concentrations of the purified products were measured with a Qubit 3.0 fluorometer (Thermo Fisher Scientific, Tokyo, Japan). The purified products were mixed in equal molar. The 16 S rRNA gene libraries were sequenced with 2 × 300 bp paired-end reads on the MiSeq systems (Illumina, Tokyo, Japan), using MiSeq v3 reagent kits (Illumina, Tokyo, Japan) (BioProject PRJDB11197). Sequences were grouped as Operational Taxonomic Units (OTUs), assigned to taxonomic groups using the Greengenes database, and clustered with the help of CLC Microbial Genomics Module software(QIAGEN, Tokyo, Japan). An analysis of Chao1 (alpha) diversity index was performed with the CLC Microbial Genomics Module.

Fungal DNA was extracted using a combination of enzymatic lysis with lysozyme, mutanolysin, and lysostaphin, and mechanical lysis methods using the FastPrep-24 as described by the manufacturers of the FastDNA Spin Kit (MP Biomedicals, LLC, Solon, OH, USA). Libraries were prepared with a modified version of the Illumina 16S Metagenomic Sequencing Library Preparation guide (Part no. 15044223 Rev. B). The internal transcribed spacer (ITS) 1 region was PCR amplified (increased from 25 to 28 cycles) using primer set ITS1-30F/ITS1-217R, which sequences are GTCCCTGCCCTTTGTACACA and TTTCGCTGCGTTCTTCATCG [11 (link)]. A subsequent index PCR was performed with 9 cycles instead of 8. Samples underwent 2x250 cycles of paired-end sequencing in three separate sequencing runs on Illumina HiSeq (Illumina Inc., San Diego, CA, USA).

Nodule, nodule‐surface mud and sediment (0.5 g) samples were thawed, and DNA was extracted using the ISOIL for Beads Beating kit (Nippon Gene, Tokyo, Japan) according to the manufacturer's protocol. For the water samples, DNA was extracted from the stored filtration units using a previously described protocol (Takebe et al., 2020 ). The V3‐V4 hypervariable region of the 16S rRNA gene was amplified by PCR using primers 341F (5′‐CCTACGGGRSGCAGCAG‐3′) and 805R (5′‐GACTACCAGGGTATCTAAT‐3′), with overhang adapters (forward: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, reverse: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) (Takahashi et al., 2014 (link)). Libraries were prepared according to the 16S Metagenomic Sequencing Library Preparation guide (#15044223 Rev. B; Illumina, San Diego, CA, USA). Paired‐end (2 × 300 bp) sequencing was conducted using an MiSeq platform (Illumina).