Log In Sign up
The largest database of trusted experimental protocols

Ab34735

Manufactured by Abcam
Visit Supplier
Sourced in United States

Ab34735 is a laboratory equipment product. It is a scientific instrument used for a specific function in a laboratory setting. No additional details about the product's core function or intended use are provided.

Automatically generated - may contain errors

Lab products found in correlation

Ab13970, by Abcam (3 mentions) Prolong gold antifade mountant, by Thermo Fisher Scientific (3 mentions) Fluoromount g, by Southern Biotech (2 mentions) Ab52865, by Abcam (2 mentions) Ab22035, by Abcam (2 mentions) Ab46020, by Abcam (2 mentions) Ab77095, by Abcam (2 mentions) Ab5392, by OriGene (2 mentions) Ab16287, by Abcam (2 mentions) Ab18465, by Abcam (2 mentions) Ab19857, by Abcam (2 mentions) Ab1543p, by Synaptic Systems (2 mentions) Ta314730, by Abcam (2 mentions) Polyvinylidene fluoride membrane, by Merck Group (2 mentions) Anti satb2, by Abcam (2 mentions) Ecl western blotting protocol, by GE Healthcare (2 mentions) Am4300, by Thermo Fisher Scientific (2 mentions) Anti pde10a sab2700582, by Merck Group (2 mentions) Mabs1753, by Merck Group (2 mentions) Anti phospho pka c thr197, by Cell Signaling Technology (2 mentions)

11 protocols using ab34735

1

Immunofluorescence Staining of Mouse Brain

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mice were anesthetized with phenytoin/pentobarbital and perfused with phosphate-buffered saline (PBS; pH 7.4), followed by 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB; pH = 7.4). After an overnight post-fix in 4% PFA, brains were cryoprotected overnight in 30% sucrose before being embedded in OCT and stored at −80 °C. Free-floating sections (30 µm) were prepared with a cryostat. They underwent three washes in PBST (PBS + 0.3% Triton X-100) and were blocked in 3% normal donkey serum in PBST (1–2 h). Sections were then incubated overnight at 4 °C in primary antibodies, including rabbit anti-Satb2 1:2500 (ab34735, Abcam), mouse anti-Satb2 1:1500 (ab34735, Abcam), rabbit anti-Fos 1:2000 (#22505, Cell Signaling; ab190289, Abcam), goat anti-Fos 1:300 (sc-52-G, Santa Cruz), chicken anti-GFP 1:10,000 (ab13970, Abcam), goat anti-CGRP 1:1000 (ab36001, Abcam), and/or rabbit anti-dsRed 1:1000 (632475, Takara). The next day, the tissue was washed three times in PBS and incubated 1–2 h in appropriate secondary antibodies including Alexa Fluor 488/594 donkey anti-sheep, Alexa Fluor 488/594 donkey anti-goat, Alexa Fluor 488/594 donkey anti-rabbit, or Alexa Fluor 488 donkey anti-chicken (1:500; Jackson Immunoresearch Laboratories). Tissue was washed three times in PBS, mounted onto glass slides, and coverslipped with Fluoromount-G (Southern Biotech).
Jarvie B.C., Chen J.Y., King H.O, & Palmiter R.D. (2021). Satb2 neurons in the parabrachial nucleus mediate taste perception. Nature Communications, 12, 224.
+ Open protocol
+ Expand
2

Immunostaining Protocol for Satb2 and GFP

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Following viral transduction, slices were fixed overnight at 4°C in 0.1 M phosphate-buffer containing 4% formaldehyde. Then, slices were rinsed with phosphate-buffer saline (PBS), permeabilized with PBS/gelatin 0.2%/Triton 0.25%, and incubated overnight at 4°C with rabbit anti-Satb2 (1:1000, ab34735, Abcam; Lee et al., 2010 (link)) and chicken anti-GFP (1:1000, GFP-1020, Aves Labs; Tricoire et al., 2010 (link)). After washing in PBS, the respective immunoreactions were visualized with the following secondary antibodies: goat-anti-rabbit AlexaFluor 555 (1:1000, A-21430, Thermo Fisher Scientific) and goat-anti chicken AlexaFluor 488 (1:1000, A-11039, Thermo Fisher Scientific) incubated 1 h at room temperature. Sections were mounted with fluoromount-G (Southern Biotech) on slides for visualization. Images of immunostained material were acquired using a Leica TCS SP5 AOBS inverted confocal microscope with a 40× objective (40× HCX P APO CS NA 1.25–0.75/Oil) and LAS AF software (Leica Microsystems). Cell counting was performed using Image Pro Analyzer 7.0.0.951 (MediaCybernetics).
Piquet J., Toussay X., Hepp R., Lerchundi R., Le Douce J., Faivre É., Guiot E., Bonvento G, & Cauli B. (2018). Supragranular Pyramidal Cells Exhibit Early Metabolic Alterations in the 3xTg-AD Mouse Model of Alzheimer’s Disease. Frontiers in Cellular Neuroscience, 12, 216.
+ Open protocol
+ Expand
3

Immunohistochemistry of E16.5 Mouse Brains

Check if the same lab product or an alternative is used in the 5 most similar protocols
Isolated E16.5 embryonic brains were fixed immediately for 24 h in 4% PFA in PBS at 4°C. Brains were then cryoprotected in 10% sucrose for 2 h then in 30% sucrose (in PBS) overnight, embedded in Tissue-Tek, stored at −20°C, and cryosectioned 12 μm. Sections on coverslips were preblocked with 2% BSA, 0.5% Triton (in PBS) for 1 h. Primary antibodies (Satb2, 1:500, Abcam (ab34735), Tbr1, 1:500, Abcam (ab31940) and anti-GFP (chicken, Aves Labs, 1:1,000) were applied in blocking solution overnight at 4°C. Fluorescent 11 secondary antibodies were applied according to the manufacturer’s protocol (Life Technologies). The coverslips were counterstained with Hoechst mounted with ImmoMount and imaged with a confocal laser-scanning microscope Leica (SP5). Data were processed with ImageJ software.
Sahu S.K., Garding A., Tiwari N., Thakurela S., Toedling J., Gebhard S., Ortega F., Schmarowski N., Berninger B., Nitsch R., Schmidt M, & Tiwari V.K. (2015). JNK-dependent gene regulatory circuitry governs mesenchymal fate. The EMBO Journal, 34(16), 2162-2181.
+ Open protocol
+ Expand
4

Satb2-Mediated Dlx1 Regulation in Mouse Hypothalamus

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assay was performed using hypothalamic tissues of wild-type mice (E16.5) according to the manufacturer’s protocol of SimpleChIP Plus Sonication Chromatin IP Kit (#56383, Cell signaling technology). The supernatant was immunoprecipitated with a rabbit anti-Satb2 antibody (ab34735, Abcam). Co-precipitated DNA was purified and relative DNA abundance of regions of interest was measured by real-time PCR. The following primers were used for PCR: Dlx1-MAR1: 5′AGCCTCACCTTGTGGTTTGG3′ and 5′GCAGCATGTTGGTTGGAGC3′; Dlx1-MAR2: 5′CCAGGTCGCTTTAAAGTAAGACAC3′ and 5′CAACAGAACGGAAAGAGGCTAAGC3′; Dlx1-MAR3: 5′GTGACTTCTCTAGCAAGGAGAC3′ and 5′CTAAAGACCGCCTTCCTTGAGC3′. Three animals were used for the ChIP assay for each group.
Zhang Q., Zhang L., Huang Y., Ma P., Mao B., Ding Y.Q, & Song N.N. (2021). Satb2 regulates the development of dopaminergic neurons in the arcuate nucleus by Dlx1. Cell Death & Disease, 12(10), 879.
+ Open protocol
+ Expand
5

Immunostaining of Pluripotent and Neural Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were fixed in 4% paraformaldehyde for 10–20 min, washed with PBS three times (5 min each), permeabilized with 0.1% triton X-100 for 15 min, incubated in blocking solution (2% BSA) for 1 hour at RT and then in primary antibodies (goat anti-Nanog, Abcam ab77095, 1:500; rabbit anti-Lin28, Abcam ab46020, 1:500; rabbit anti-Oct4, Abcam ab19857, 1:500; mouse anti-SSEA4, Abcam ab16287, 1:200; mouse anti-Nestin, Abcam ab22035, 1:200; rabbit anti-Musashi1, Abcam ab52865, 1:250; rat anti-CTIP2, Abcam ab18465, 1:250; rabbit anti-SATB2, Abcam ab34735, 1:200; chicken anti-MAP2, Abcam ab5392, 1:1000; rabbit anti-FZD9, Origene TA314730, 1:150; chicken anti-EGFP, Abcam ab13970, 1:1000; rabbit anti-Synapsin1, EMD-Millipore AB1543P, 1:500; mouse anti-Vglut1, Synaptic Systems 135311, 1:500; rabbit anti-Homer1, Synaptic Systems 160003, 1:500) overnight at 4°C. The next day, cells were washed with PBS three times (5 min each), incubated with secondary antibodies (Alexa Fluor 488, 555 and 647, Life Technologies, 1:1000) for 1 hour at RT, and washed with PBS three times (5 min each). Nuclei were stained using DAPI (1:10,000). Slides or coverslips were mounted using ProLong Gold antifade mountant (Life Technologies).
Chailangkarn T., Trujillo C.A., Freitas B.C., Hrvoj-Mihic B., Herai R.H., Yu D.X., Brown T.T., Marchetto M.C., Bardy C., McHenry L., Stefanacci L., Järvinen A., Searcy Y.M., DeWitt M., Wong W., Lai P., Ard M.C., Hanson K.L., Romero S., Jacobs B., Dale A.M., Dai L., Korenberg J.R., Gage F.H., Bellugi U., Halgren E., Semendeferi K, & Muotri A.R. (2016). A human neurodevelopmental model for Williams syndrome. Nature, 536(7616), 338-343.
+ Open protocol
+ Expand
6

Western Blot Analysis of Protein Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Protein samples were separated on SDS-PAGE gels and then transferred to polyvinylidene fluoride membranes (Millipore). Membranes were processed according to the ECL Western Blotting Protocol (GE Healthcare). Anti-PDE10A (SAB2700582; Sigma-Aldrich), anti-SATB2 (ab34735; Abcam), anti-PTPN2 (MABS1753; Millipore), anti-DNMT3A (3598S; CST), anti-PKA C-α (4782S; CST), anti-Phospho-PKA C (Thr197) (5661S; Cell Signaling Technology), and anti-PSD-95 (MAB1598; Millipore) were used as primary anntibodies at a 1:1,000 dilution. HRP-labeled secondary antibodies were obtained from Cell Signaling Technology (7074S & 7076S) and were used at a dilution of 1:5,000. The antibodies against GAPDH (AM4300; Thermo Fisher) or Actin (A5060; Sigma-Aldrich) were used for loading controls. All Western blot quantifications were performed using ImageJ software. Full Western blotting images are summarized in Supplementary Fig. 15.
Cheng Y., Wang Z.M., Tan W., Wang X., Li Y., Bai B., Li Y., Zhang S.F., Yan H.L., Chen Z.L., Liu C.M., Mi T.W., Xia S., Zhou Z., Liu A., Tang G.B., Liu C., Dai Z.J., Wang Y.Y., Wang H., Wang X., Kang Y., Lin L., Chen Z., Xie N., Sun Q., Xie W., Peng J., Chen D., Teng Z.Q, & Jin P. (2018). Partial loss of psychiatric risk gene miR-137 in mice causes repetitive behavior and impairs sociability and learning via increased Pde10a. Nature neuroscience, 21(12), 1689-1703.
+ Open protocol
+ Expand
7

Immunostaining of Pluripotent and Neural Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were fixed in 4% paraformaldehyde for 10–20 min, washed with PBS three times (5 min each), permeabilized with 0.1% triton X-100 for 15 min, incubated in blocking solution (2% BSA) for 1 hour at RT and then in primary antibodies (goat anti-Nanog, Abcam ab77095, 1:500; rabbit anti-Lin28, Abcam ab46020, 1:500; rabbit anti-Oct4, Abcam ab19857, 1:500; mouse anti-SSEA4, Abcam ab16287, 1:200; mouse anti-Nestin, Abcam ab22035, 1:200; rabbit anti-Musashi1, Abcam ab52865, 1:250; rat anti-CTIP2, Abcam ab18465, 1:250; rabbit anti-SATB2, Abcam ab34735, 1:200; chicken anti-MAP2, Abcam ab5392, 1:1000; rabbit anti-FZD9, Origene TA314730, 1:150; chicken anti-EGFP, Abcam ab13970, 1:1000; rabbit anti-Synapsin1, EMD-Millipore AB1543P, 1:500; mouse anti-Vglut1, Synaptic Systems 135311, 1:500; rabbit anti-Homer1, Synaptic Systems 160003, 1:500) overnight at 4°C. The next day, cells were washed with PBS three times (5 min each), incubated with secondary antibodies (Alexa Fluor 488, 555 and 647, Life Technologies, 1:1000) for 1 hour at RT, and washed with PBS three times (5 min each). Nuclei were stained using DAPI (1:10,000). Slides or coverslips were mounted using ProLong Gold antifade mountant (Life Technologies).
Chailangkarn T., Trujillo C.A., Freitas B.C., Hrvoj-Mihic B., Herai R.H., Yu D.X., Brown T.T., Marchetto M.C., Bardy C., McHenry L., Stefanacci L., Järvinen A., Searcy Y.M., DeWitt M., Wong W., Lai P., Ard M.C., Hanson K.L., Romero S., Jacobs B., Dale A.M., Dai L., Korenberg J.R., Gage F.H., Bellugi U., Halgren E., Semendeferi K, & Muotri A.R. (2016). A human neurodevelopmental model for Williams syndrome. Nature, 536(7616), 338-343.
+ Open protocol
+ Expand
8

Western Blot Analysis of Protein Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Protein samples were separated on SDS-PAGE gels and then transferred to polyvinylidene fluoride membranes (Millipore). Membranes were processed according to the ECL Western Blotting Protocol (GE Healthcare). Anti-PDE10A (SAB2700582; Sigma-Aldrich), anti-SATB2 (ab34735; Abcam), anti-PTPN2 (MABS1753; Millipore), anti-DNMT3A (3598S; CST), anti-PKA C-α (4782S; CST), anti-Phospho-PKA C (Thr197) (5661S; Cell Signaling Technology), and anti-PSD-95 (MAB1598; Millipore) were used as primary anntibodies at a 1:1,000 dilution. HRP-labeled secondary antibodies were obtained from Cell Signaling Technology (7074S & 7076S) and were used at a dilution of 1:5,000. The antibodies against GAPDH (AM4300; Thermo Fisher) or Actin (A5060; Sigma-Aldrich) were used for loading controls. All Western blot quantifications were performed using ImageJ software. Full Western blotting images are summarized in Supplementary Fig. 15.
Cheng Y., Wang Z.M., Tan W., Wang X., Li Y., Bai B., Li Y., Zhang S.F., Yan H.L., Chen Z.L., Liu C.M., Mi T.W., Xia S., Zhou Z., Liu A., Tang G.B., Liu C., Dai Z.J., Wang Y.Y., Wang H., Wang X., Kang Y., Lin L., Chen Z., Xie N., Sun Q., Xie W., Peng J., Chen D., Teng Z.Q, & Jin P. (2018). Partial loss of psychiatric risk gene miR-137 in mice causes repetitive behavior and impairs sociability and learning via increased Pde10a. Nature neuroscience, 21(12), 1689-1703.
+ Open protocol
+ Expand
9

Multiplexed smFISH and Immunocytochemistry

Check if the same lab product or an alternative is used in the 5 most similar protocols
smFISH targeting nascent RNA of HES1 or BCL11A were performed using RNAscope® Multiplex Fluorescent Reagent Kit v2(ACDBio). Probes binding the intronic region of target genes were designed and synthesized by ACDBio. FISH signal was labeled with TSA Plus Cyanine 5 (Perkin Elmer). Immunocytochemistry was carried out after FISH procedure [22 ]. Antibodies targeting GFP(Abcam, ab1218), mCherry (Abcam, ab205402), GFAP (Ab4648) and SATB2 (Abcam, ab34735) were incubated overnight. Secondary antibodies including Alexa Fluor 594 Goat anti-chicken IgY secondary antibody (Thermo Fisher Scientific, A11042), Alexa Fluor 488 donkey anti-mouse IgG secondary antibody (Thermo Fisher Scientific, A21202), Alexa Fluor 546 donkey anti-mouse IgG secondary antibody (Thermo Fisher Scientific, A10036) and Alexa Fluor 488 donkey anti-rabbit IgG secondary antibody (Thermo Fisher Scientific, A21206) were incubated at RT for 1hr. Nuclei are stained with DAPI for 5 min before mounting with ProLong™ Gold Antifade Mountant (Thermo Fisher Scientific, P36930).
Yang X., Bergenholtz S., Maliskova L., Pebworth M.P., Kriegstein A.R., Li Y, & Shen Y. (2020). SMART-Q:  An Integrative Pipeline Quantifying Cell Type-Specific RNA Transcription. PLoS ONE, 15(4), e0228760.
+ Open protocol
+ Expand
10

Immunofluorescence Characterization of Cerebral Organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cerebral organoids were fixed overnight in 4% paraformaldehyde at 4°C. The following day, the Matrigel was removed, and the organoids were incubated in fresh 4% paraformaldehyde for 1 h at 4°C. Subsequently, the organoids were allowed to sink in a 30% sucrose solution at 4°C and then were embedded in optimal cutting temperature (OCT) compound (Scigen, Gardena, CA, USA) and incubated at −80°C for 1 d. Thereafter, the organoids were cryosectioned into 20-μm-thick sections, permeabilized in 0.3% Triton X-100, and blocked with a 3% bovine serum albumin solution for 1 h. The sections were then incubated overnight with primary antibodies at 4°C. The following antibodies were used in this study: anti-SOX2 (AB5603, Sigma), anti-PAX6 (MA1-109, Invitrogen, Carlsbad, CA, USA), anti-SATB2 (ab34735, Abcam), anti-O4 (MAB1326, R&D system, MN, USA), anti-O1 (MAB1327, R&D system), anti-GFAP (ab7260, Abcam) anti-DAPI (D1306, Invitrogen), and anti-TUJ1 (801202, BioLegend, San Diego, CA, USA). The following secondary antibodies were purchased from Invitrogen: Alexa Fluor 594 (A21207 and A21203) and Alexa Fluor 488 (A21206 and 21202). Immunofluorescence was detected by confocal microscopy (LSM800; Carl Zeiss, Oberkochen, Germany), and analysis was performed using ZEN 2 blue edition software (Carl Zeiss).
Seo H.H., Han H.W., Lee S.E., Hong S.H., Cho S.H., Kim S.C., Koo S.K, & Kim J.H. (2020). Modelling Toxoplasma gondii infection in human cerebral organoids. Emerging Microbes & Infections, 9(1), 1943-1954.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!