Dulbecco modified eagle medium (dmem)
DMEM (Dulbecco's Modified Eagle's Medium) is a cell culture medium commonly used to support the growth and maintenance of mammalian cells in vitro. It provides a balanced salt solution, amino acids, vitamins, and other essential nutrients required for cell survival and proliferation.
Lab products found in correlation
34 protocols using dulbecco modified eagle medium (dmem)
Isolation and Characterization of Rat Bone Marrow-Derived Mesenchymal Stem Cells
Oxidative Stress Induction in Human Trabecular Meshwork Cells
Cell Culture and Transfection Protocols
The siRNAs compounds targeting CTSE (siCTSE-1: 5’- CAACUACUUGGAUAUGGAAUA- 3’; siCTSE-2: 5’ – CAAUCUUUCUCCAUUCAGUAU – 3’) were designed by GenePharma (Suzhou, China). Transfection was performed using lipofectamine 3000 (Invitrogen) following the manufacturer’s instructions. Overexpression plasmid pcDNA3.1-POU5F1 and corresponding empty vector were purchased from Obio Technology Corp.
Investigating BCR-ABL Signaling in K562 Cells
Cell Cycle Regulation Protocol
Culturing Bladder Cancer Cell Lines
Evaluating Cardioprotective Effects of DXXK
Breast Cancer Cell Migration and Invasion
To investigate the invasiveness of MCF7 and MDA-MB-231 cells, the stroma was diluted in DMEM without FBS at a ratio of 1:7 (Beyotime, Guangzhou, China). An aliquot of 50 μL was aspirated into the upper chamber and allowed to rest for 3–4 h. The rest of the procedure was the same as that described for the migration assay.
Novel Flavonoid Derivative GL-V9 Evaluation
Paclitaxel injection was purchased from Haikou Pharmaceutical Factory. Dorsomorphin Dihydrochloride (Compound C, C24H27ClN5O, MW 472.41 and purity 99.73%) was purchased from MedChem Express and dissolved in DMSO to 5 mM. N-acetyl-
Culturing and Transfecting Human ESCC Cell Lines
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!