Novoscript plus all in one 1st strand cdna synthesis supermix

L. monocytogenes EGD was co-incubated with atractylodin (0, 4, 8 μg/mL) for 8 h and then total RNA of bacteria was extracted with TRIzol (Invitrogen). And the RNA was reverse-transcribed to cDNA using NovoScript^® Plus All-in-one 1st Strand cDNA Synthesis SuperMix (E047; Novoprotein, Shanghai, China). The levels of mRNA of hly in each sample were determined by real-time quantitative polymerase chain reaction (RT-qPCR) with NovoScript^®SYBR qPCR SuperMix Plus (E096; Novoprotein, Shanghai, China). The data were collected and analyzed by the 2^−ΔΔCt method and normalized to 16sRNA. The mRNA level of the target genes in J774A.1 macrophages was detected by RT-qPCR as described above and GAPDH was used as an internal control. The primer pairs used for RT-qPCR are listed in Supplementary Table 1.

Approximately 2 mm of tissue was collected from the distal regions of uninjured lungs at 0 dpa (days‐post‐amputation) and injured lungs at 10 dpa, respectively. The removed tissue was placed in a petri dish poured with PBS to remove the blood cells. Total RNA was extracted by using TRIzol reagent (SimGen). The cDNA was synthesized by using NovoScript Plus All‐in‐one 1st Strand cDNA Synthesis SuperMix (Novoprotein). RT‐qPCR assay was performed by using a Hieff qPCR SYBR Green Mix (YEASEN) on BIO‐RAD CFX96 real‐time PCR system. In brief, 1 μg total RNA was subjected to reverse transcription in 20 μl final volume containing 10 mM dNTP mix and 2 M of anchored oligo‐dt. The mixture was incubated at 50°C for 15 min, 75°C for 5 min. The RT‐qPCR conditions were: initial denaturation at 95°C for 5 min, followed by 39 cycles of 95°C for 20 s, 60°C for 20 s, and 72°C for 20 s. The relative amount of Krt5, Trp63, and Igta6 mRNA was normalized to the amount of actin, respectively. The 2^−ΔΔCt method was used for evaluation of relative quantification of target gene expression. Primers are described below: actin‐F: TTGTGATGGATTCTGGTGATGGT, actin‐R: GAACTGAACCGACCAGCACT, Krt5‐F: CATCCAACGGGTGCGAAAAG, Krt5‐R: TCGTTCTCAGCAGCTGTACG, Trp63‐F: TTGCCGCAGTACACAAACCT, Trp63‐R: GTGTTGTACGGACTCGTGGA, Igta6‐F: TCTTGGAACCTGCACAAGGG, and Igta6‐R: CACGTTTTCGCGCTTCTCAT.

Total RNA from cells was extracted using the Total RNA kit I (Omega Biotek). RNA concentration was detected using Nanodrop (Thermo Fisher Scientific). RNA was reverse‐transcribed into cDNA by NovoScript Plus All‐in‐one 1st Strand cDNA Synthesis SuperMix (Novoprotein). Finally, RT‐qPCR was performed to detect the expression level of NUP37 using Novostart SYBR qPCR SuperMix Plus Kit (Novoprotein). Primers were manifested as follows: GAPDH forward 5′‐CAAGGTCATCCATGACAACTTTG‐3′ and GAPDH reverse 5′‐GTCCACCAC CCTGTTGCTGTAG‐3′; NUP37 forward 5′‐TAGGACACCCTCAGCCCATC‐3′ and NUP37 reverse 5′‐TTCAGTCACCCAAAACAACA‐3′. The relative NUP37 expression levels were determined using the 2^−ΔΔCT.

Total RNA was extracted using the Total RNA Extraction Kit (Boxbio, Beijing, China). Subsequently, cDNA was synthesized using the NovoScript® Plus All-in-one 1st Strand cDNA Synthesis SuperMix (Novoprotein, Shanghai, China). The gene transcripts of interest were quantitated using the QuantStudio Three Real-Time PCR System (Thermo Fisher) using the NovoStart® SYBR qPCR SuperMix Plus (Novoprotein), with ACTB as an internal control. The primer sequence used during our quantitative real-time polymerase chain reaction (qRT-PCR) test is shown in Supplementary Table 3.

Mice exposed to the short-term alcoholic diet were executed to collect liver tissues. In addition, liver tissues were polished on ice and were used to extract RNA by an RNeasy animal RNA isolation kit with spin column (R0027, Beyotime). Novoscript plus all-in-one 1st strand cDNA synthesis supermix (E047-01A, Novoprotein) was used to RNA reverse transcription, and Novostart SYBR qPCR supermix plus (E096-01A, Novoprotein) were used to amplify target gene under the action of specific primers. The detailed primers sequences were shown in Table S2.

RT‐qPCR was used to detect the expression of ITGB3BP in glioma cells and tissues. Total RNA Kit I (Omega, Biotek) and Trizol Reagent (Thermo Fisher Scientific) were used to extract total RNA from cells and tissues respectively. RNA reverse transcription was performed using NovoScript Plus All‐in‐one 1st Strand cDNA Synthesis SuperMix (Novoprotein). NovoStart SYBR qPCR SuperMix Plus (Novoprotein) was used to perform RT‐qPCR to determine RNA expression levels. GAPDH expression was used to normalize ITGB3BP expression, and the primer sequences of ITGB3BP and GAPDH were as follows: ITGB3BP‐Forward: GCGTTTCCTTTGGCGGATTT, ITGB3BP‐Reverse: AGTGATCTTTTAACAGGCATTCTGA, GAPDH‐Forward: CAAGGTCATCCATGACAACTTTG, and GAPDH‐Reverse: GTCCACCACCCTGTTGCTGTAG.

Total RNA was extracted from cultured cells using a RNeasy Mini kit (250) (QIAGEN), and equal amounts of RNA were reverse transcribed using Novo Script Plus All‐in‐One 1st Strand cDNA Synthesis SuperMix (Novoprotein). The generated cDNA was subjected to real‐time PCR with SYBR Green reagent (Roche) using the following mouse primers:
GAPDH forward, 5′‐ACCACAGTCCATGCCATCAC‐3′; GAPDH reverse, 5′‐TCCACCACCCTGTTGCTGTA‐3′; IL‐22 forward, 5′‐TCCGAGGAGTCA GTGCTAAA‐3′; and IL‐22 reverse, 5′‐AGA ACGTCTTCCAGGGTGAA‐3′.
The other primers are mentioned above. Relative mRNA abundance was calculated using the ΔCt or ΔΔCt method, and the gene expression level was normalized to that of GAPDH.