Log In Sign up
The largest database of trusted experimental protocols

High capacity cdna reverse transcription system

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United Kingdom, United States

The High-Capacity cDNA Reverse Transcription System is a laboratory instrument designed for the conversion of RNA into complementary DNA (cDNA). This system provides a reliable and efficient method for reverse transcription, a key step in various molecular biology applications such as gene expression analysis, RNA sequencing, and cDNA library construction.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (7 mentions) Sybr premix ex taqtm, by Thermo Fisher Scientific (4 mentions) Fast sybr green master mix, by Thermo Fisher Scientific (4 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions) Biodrop duo, by Harvard Bioscience (3 mentions) Viia 7 real time pcr system, by Thermo Fisher Scientific (3 mentions) Rna isolation kit, by Qiagen (3 mentions) Sybr green master mix, by Thermo Fisher Scientific (3 mentions) Cfx cfx96 real time pcr system, by Bio-Rad (2 mentions) Nanodrop 2000, by Agilent Technologies (2 mentions) Cfx96 real time pcr system, by Bio-Rad (2 mentions) Nanodrop 2000, by Thermo Fisher Scientific (2 mentions) Lipopolysaccharides (lps), by Merck Group (1 mentions) Dexamethasone (dex), by Merck Group (1 mentions) Abi prism 7700 sequence, by Thermo Fisher Scientific (1 mentions) Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (1 mentions) Bioanalyzer platform, by Agilent Technologies (1 mentions) Dnase 1, by Promega (1 mentions)

14 protocols using high capacity cdna reverse transcription system

1

Cytokine Gene Expression Analysis in Cornea

Check if the same lab product or an alternative is used in the 5 most similar protocols
The corneas were snap frozen in liquid nitrogen and homogenized carefully into tissue powder using pre-frozen (in liquid nitrogen) porcelain mortar and pestles. Total RNA was purified from this frozen powder with TRIzol reagent (Life Technologies, Grand Island, NY) according to the manufacturer’s instruction. 3 μg of total RNA was reverse-transcribed to cDNA using high-capacity cDNA reverse transcription system (Life Technologies) according to the manufacturer’s instructions. qRT-PCR was performed with fastSYBR Green Master Mix (Life Technologies) by a StepOnePlus Real-Time PCR System (Life Technologies). The primers for the following cytokines were used for amplification: TNF-α, IL-1β, MCP-1, IL-6 and VEGF (see Table 2 for primer sequences). The expression of rat GAPDH mRNA was used to normalize the expression levels of target genes and was calculated by the comparative cycle threshold Ct method (2−ΔΔCt).
Soiberman U., Kambhampati S.P., Wu T., Mishra M.K., Oh Y., Sharma R., Wang J., Al Towerki A.E., Yiu S., Stark W.J, & Kannan R.M. (2017). Subconjunctival injectable dendrimer-dexamethasone gel for the treatment of corneal inflammation. Biomaterials, 125, 38-53.
+ Open protocol
+ Expand
2

Quantifying Xc- Transporter Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cell pellets were snap frozen in liquid nitrogen and stored in − 80 °C until analysis. Total RNA was extracted with 500 μL of TRIzol reagent (Life Technologies, Grand Island, NY, USA) according to the manufacturer’s instruction, and the extracted RNA was purified using ethanol. Two micrograms for total RNA was reverse transcribed to complementary DNA (cDNA) using a high-capacity cDNA reverse transcription system (Life Technologies) according to the manufacturer’s instructions. qRT-PCR was performed with Fast SYBR Green Master Mix (Life Technologies) by a StepOnePlus Real-Time PCR System (Life Technologies) on GAPDH (forward: TGTCGTGGAGTCTACTGGTGTCTTC; reverse: CGTGGTTCACACCCATCACAA) and Xc− (forward: CTTCGATACAAACGCCCAGATA; reverse: CTGAATGGGTCCGAGTAAAGAG). The expression of GAPDH messenger RNA (mRNA) was used to normalize the expression levels of target genes and was calculated by the comparative cycle threshold Ct method (2−ΔΔCt). Data is expressed as fold change from wild type.
Nance E., Kambhampati S.P., Smith E.S., Zhang Z., Zhang F., Singh S., Johnston M.V., Rangaramanujam K., Blue M.E, & Kannan S. (2017). Dendrimer-mediated delivery of N-acetyl cysteine to microglia in a mouse model of Rett syndrome. Journal of Neuroinflammation, 14, 252.
+ Open protocol
+ Expand
3

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from cells was extracted with TRIzol reagent (Life Technologies, Grand Island, NY, USA) following the protocol provided by the manufacturer. RNA concentration was measured using BioDrop Duo (Biodrop, Cambridge, UK). cDNA was synthesized from 2 µg of total RNA using the High-Capacity cDNA Reverse Transcription System (Life Technologies). Comparative quantitative RT-PCR (qPCR) was performed in duplicate for each sample using SYBR® Premix Ex TaqTM (Life Technologies) and CFX CFX96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA). RT-PCRs were performed using the primers listed in Table 1. Expression levels of mRNA were quantified by use of the threshold cycle (Ct) method. Ct values for each gene of in­terest were normalized to GAPDH.
Park Y.J., Lee S.R., Kim D.M., Yu J.S., Beemelmanns C., Chung K.H, & Kim K.H. (2018). The Inhibitory Effects of Cyclodepsipeptides from the Entomopathogenic Fungus Beauveria bassiana on Myofibroblast Differentiation in A549 Alveolar Epithelial Cells. Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry, 23(10), 2568.
+ Open protocol
+ Expand
4

RNA Isolation and qPCR Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using TRIzol reagent (Life Technologies, Grand Island, NY, USA) following the protocol provided by the manufacturer [68 (link),69 (link)]. RNA concentration was measured using BioDrop Duo (BioDrop, Cambridge, UK), and cDNA was synthesized by using a High-Capacity cDNA Reverse Transcription System (Life Technologies). qPCR was performed in duplicate for each sample using SYBR® Premix Ex TaqTM (Life Technologies) and a CFX CFX96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA). qPCR was performed using the primers listed in Table 1. The mRNA expression level of genes of interest was normalized to that of GAPDH.
Park Y.J., Lee K.H., Jeon M.S., Lee Y.H., Ko Y.J., Pang C., Kim B., Chung K.H, & Kim K.H. (2020). Hepatoprotective Potency of Chrysophanol 8-O-Glucoside from Rheum palmatum L. against Hepatic Fibrosis via Regulation of the STAT3 Signaling Pathway. International Journal of Molecular Sciences, 21(23), 9044.
+ Open protocol
+ Expand
5

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from cultured cells was extracted with a RNA isolation kit (Qiagen, CA) following the instruction provided by the company. RNA concentration was measured spectrophotometrically using NanoDrop 2000 (Biotek, Winooski, VT). 1-2 μg of total RNA were reverse-transcribed to cDNA using the High-Capacity cDNA Reverse Transcription System (Life Technologies, Grand Island, NY). Comparative quantitative RT-PCR (qPCR) was performed in duplicate or triplicate for each sample using fast SYBR Green Master Mix (Life Technologies) and ViiA 7 Real-Time PCR System (Applied Biosystems, Foster City, CA). The expression levels of target genes were normalized to the expression of β-actin and calculated based on the comparative cycle threshold Ct method (2−ΔΔCt). Name and sequences of primers are summarized in Supplementary Table 6.
Yun S.P., Kam T.I., Panicker N., Kim S., Oh Y., Park J.S., Kwon S.H., Park Y.J., Karuppagounder S.S., Park H., Kim S., Oh N., Kim N.A., Lee S., Brahmachari S., Mao X., Lee J.H., Kumar M., An D., Kang S.U., Lee Y., Lee K.C., Na D.H., Kim D., Lee S.H., Roschke V.V., Liddelow S.A., Mari Z., Barres B.A., Dawson V.L., Lee S., Dawson T.M, & Ko H.S. (2018). Block of A1 astrocyte conversion by microglia is neuroprotective in models of Parkinson’s disease. Nature medicine, 24(7), 931-938.
+ Open protocol
+ Expand
6

Quantitative Analysis of TNFα Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary microglia cells were pre-incubated for 1 h with 100 nM dexamethasone (Sigma) and MIF or D-DT with or without PAANIB-1 before adding 100 ng/ml LPS (Sigma). TNFα levels were measured by comparative quantitative real time PCR (qPCR) (Merk et al., 2011 (link)). Total RNA was extracted with RNA isolation kit (Qiagen) and then reverse-transcribed to cDNA using the High-Capacity cDNA Reverse Transcription System (Life Technologies). qPCR was performed in duplicated or triplicated for each sample using fast SYBR Green Master Mix (Life Technologies) and ViiA 7 Real-Time PCR System (Applied Biosystems). The expression levels of TNFα were normalized to the expression of β-actin.
Park H., Kam T.I., Peng H., Chou S.C., Mehrabani-Tabari A.A., Song J.J., Yin X., Karuppagounder S.S., Umanah G.K., Subba Rao A.V., Choi Y., Aggarwal A., Chang S., Kim H., Byun J., Liu J.O., Dawson T.M, & Dawson V.L. (2022). PAAN/MIF nuclease inhibition prevents neurodegeneration in Parkinson’s disease. Cell, 185(11), 1943-1959.e21.
+ Open protocol
+ Expand
7

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from cultured cells was extracted with a RNA isolation kit (Qiagen, CA) following the instruction provided by the company. RNA concentration was measured spectrophotometrically using NanoDrop 2000 (Biotek, Winooski, VT). 1-2 μg of total RNA were reverse-transcribed to cDNA using the High-Capacity cDNA Reverse Transcription System (Life Technologies, Grand Island, NY). Comparative quantitative RT-PCR (qPCR) was performed in duplicate or triplicate for each sample using fast SYBR Green Master Mix (Life Technologies) and ViiA 7 Real-Time PCR System (Applied Biosystems, Foster City, CA). The expression levels of target genes were normalized to the expression of β-actin and calculated based on the comparative cycle threshold Ct method (2−ΔΔCt). Name and sequences of primers are summarized in Supplementary Table 6.
Yun S.P., Kam T.I., Panicker N., Kim S., Oh Y., Park J.S., Kwon S.H., Park Y.J., Karuppagounder S.S., Park H., Kim S., Oh N., Kim N.A., Lee S., Brahmachari S., Mao X., Lee J.H., Kumar M., An D., Kang S.U., Lee Y., Lee K.C., Na D.H., Kim D., Lee S.H., Roschke V.V., Liddelow S.A., Mari Z., Barres B.A., Dawson V.L., Lee S., Dawson T.M, & Ko H.S. (2018). Block of A1 astrocyte conversion by microglia is neuroprotective in models of Parkinson’s disease. Nature medicine, 24(7), 931-938.
+ Open protocol
+ Expand
8

Total RNA Isolation, cDNA Synthesis, and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using TRIzol reagent (Life Technologies, Grand Island, NY, USA) following the protocol provided by the manufacturer. RNA concentration was measured using BioDrop Duo (Biodrop, Cambridge, UK), and cDNA was synthesized by a High-Capacity cDNA Reverse Transcription System (Life Technologies). qPCR was performed in duplicate for each sample using SYBR® Premix Ex TaqTM (Life Technologies) and CFX96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA). qPCR was performed using the primers listed in Table 1. Expression levels of mRNA were normalized to GAPDH.
Park Y.J., Kim D.M., Jeong M.H., Yu J.S., So H.M., Bang I.J., Kim H.R., Kwon S.H., Kim K.H, & Chung K.H. (2019). (–)-Catechin-7-O-β-d-Apiofuranoside Inhibits Hepatic Stellate Cell Activation by Suppressing the STAT3 Signaling Pathway. Cells, 9(1), 30.
+ Open protocol
+ Expand
9

RNA Extraction and Quantification Protocol

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
As described our previous report41 (link), total RNA from cells and liver tissues was extracted by TRIzol reagent (Life Technologies, Grand Island, NY) following the manufacturer's protocol. RNA concentration was measured by using a NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA). cDNA was synthesized from 1–2 µg of total RNA by using a High-Capacity cDNA Reverse Transcription System (Life Technologies). Comparative qPCR was performed in duplicate for each sample by using SYBR Green Master Mix (Life Technologies) and StepOnePlus Real-Time PCR System (Life Technologies). mRNA expression was quantified using the threshold cycle (Ct) method. Ct values for each gene of interest were normalized to that of GAPDH. The name and sequences of primers and primers for humans and mice are summarized in Supplementary Tables 1 and 2.
Park Y.J., An H.T., Park J.S., Park O., Duh A.J., Kim K., Chung K.H., Lee K.C., Oh Y, & Lee S. (2020). Tyrosine kinase inhibitor neratinib attenuates liver fibrosis by targeting activated hepatic stellate cells. Scientific Reports, 10, 14756.
+ Open protocol
+ Expand
10

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
TRIzol reagent was used to isolate total RNA (Life Technologies, Grand Island, NY, USA). After cDNA was synthesized by the High-Capacity cDNA Reverse Transcription System (Life Technologies), qRT-PCR was performed using SYBR® Premix Ex TaqTM (Life Technologies) and CFX96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA). qRT-PCR was conducted using the primers listed in Table 1 (Bioneer, Daejeon, Korea). GAPDH was used to normalized mRNA expression levels.
Park Y.J., Kim D.M., Choi H.B., Jeong M.H., Kwon S.H., Kim H.R., Kwak J.H, & Chung K.H. (2021). Dendropanoxide, a Triterpenoid from Dendropanax morbifera, Ameliorates Hepatic Fibrosis by Inhibiting Activation of Hepatic Stellate Cells through Autophagy Inhibition. Nutrients, 14(1), 98.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!