Clc genomics workbench v7

Four Moraxella genomes were sequenced using the Illumina MiSeq platform (University of Northumbria, UK). A 2*250 bp paired-end library (Nextera XT sample prep) were utilized for each sample. The raw data was processed by trimming the library adapter sequences and quality filtering was applied using CLC genomics workbench v.7.5 (CLC Bio, Aarhus, Denmark). Quality reads below 0.05, along with reads shorter than 100 bp and with 2 or more ambiguities were removed (total values removed for strain: MC1 – 0.06%; MC5 – 16.91%, MC6 – 7.55%, MC8 – 0.05%). After trimming and filtering, the data were processed and the reads were mapped to the reference genomes. The processed reads were used for de novo assembly. A high-quality draft genome was assembled by closing the gaps between the scaffolded contigs of the reference assembly by contig stitching with de novo contigs. The four final draft genomes comprised from 3 to 5 contigs were grouped in one scaffold each. The final genome assemblies were deposited in GenBank under accession numbers CP010573, CP010900, CP010901 and CP010902. Their detailed characteristics is provided in Supplementary Table 1.
The sequence of a pseudogene SQ02_07885 in the Mc8 genome was verified by PCR analysis using the primers, F: gataagccgtataccgccattcatg, R: ctgtctgagtgttctcttgcgcccag. The obtained 1.2 kb product was resequenced (Genomed, Poland).

Illumina raw reads were collected using an Illumina Hiseq 2500 platform. The quality-trim with all of the raw reads was performed using CLC Genomics Workbench v7.5 (CLC bio, Aarhus, Denmark) with the default parameter set. The programs MITObim v1.7 (University of Oslo, Oslo, Norway) [96 (link)] and MIRA v4.0.2 (DKFZ, Heidelberg, Germany) [97 (link)] were used to perform the reference-guided assembly twice, to reconstruct the CPGs with published G. pentaphyllum (KX852298) and C. melo (JF412791) as references, respectively. A few gaps, dubious bases, and low-coverage regions in the assembled CPGs were corrected by Sanger sequencing, whereby pairs of primers were designed (Table S1) using Primer 3 version 4.0.0 (Whitehead Institute for Biomedical Research, Massachusetts, USA) [98 (link)]. The software DOGMA, Dual Organellar Genome Annotator (University of Texas at Austin, Austin, TX, USA) [99 (link)], was used to annotate the complete CPGs, and corrected by comparing with the complete CPGs of the references mentioned above using GENEIOUS R8 (Biomatters Ltd., Auckland, New Zealand). The circular CPG maps were drawn using online software OGDRAW (http://ogdraw.mpimp-golm.mpg.de) (Max planck Institute of Molecular Plant Physiology, Potsdam, Germany). All of the newly generated complete CPG sequences were submitted to GenBank (Table 1).

All genome data were sequenced using an Illumina Hiseq 2500 platform by Biomarker Technologies, Inc (Beijing, China). High-quality reads were obtained using the CLC Genomics Workbench v7.5 (CLC Bio, Aarhus, Denmark). Reference-guided assembly was then performed to reconstruct the chloroplast genomes using the program MITObim v1.7 (Christoph et al., 2013 (link)). In order to obtain accurate sequences, each species was assembled four times with the reference genomes A. cepa (KM088014), A. sativum (KY085913), A. victorialis (NC_037240), and A. obliquum (LT699701). Gaps that appeared in the assembled cp genomes were corrected by Sanger sequencing and the primers were designed using Lasergene 7.1 (DNASTAR, Madison, WI, United States). The primers and amplifications were shown in Supplementary Table S2. The program DOGMA (Wyman et al., 2004 (link)) was used to annotate the whole cp genome, and subsequently corrected within GENEIOUS R11 (Biomatters, Ltd., Auckland, New Zealand). Final plastid genome maps were drawn using OGDRAW (Lohse et al., 2013 (link)).

The assembled apple ‘Golden Delicious’ genome MalDom1.0 (NCBI accession GCA_000148765.1, annotation release 100, June 2014) (Velasco et al., 2010 (link)), which comprises 17 chromosomes with a total size of 526 197 889 bp, was used as reference. Mapping of the Illumina sequencing reads onto the reference genome was conducted in the weeping and standard pools using the software CLC Genomics Workbench (v7.5, CLCBio, Cambridge, MA, USA). The mapping parameters and settings were similar to previously described (Bai et al., 2014 (link)), i.e. the minimum length fraction was 0.8 and the minimum similarity was 0.98 (Fig. 1iv; Supplementary Table 1Supplementary Table S1).

Paired-end reads were assembled and analyzed in CLC Genomics Workbench v. 7.5 (CLC bio, Aarhus, Denmark, now QIAGEN). Non-coding RNA contigs were removed based on a BLAST search of contigs against a reference (Rfam). Pair-end sequencing results were deposited in NCBI’s Sequence Read Archive (reference: SRP131635). An Arabidopsis database (The Arabidopsis Information Resource, TAIR) was also searched for specific annotations of expressed genes. Genes with the highest bitscore were kept when multiple F. microcarpa genes were mapped onto duplicate Arabidopsis orthologs. The DESeq2 Bioconductor package was applied to determine the differential expressed gene (DEG) [43 (link)]. An analysis of the preference of functional gene categories was performed with MapMan (v. 3.5.1, with PageMan integrated [44 (link)]) by imputing the ID of Arabidopsis orthologues. The Wilcoxon statistical test was applied with the Benjamini–Hochberg procedure.

All four citrus-associated strains were procured from BCCM-LMG culture collection and were grown as per the instructions. Genomic DNA was extracted by using a ZR Fungal/Bacterial DNA MiniPrep kit (Zymo Research). DNA quality checking was carried out using a NanoDrop 1000 instrument (Thermo Fisher Scientific) and agarose gel electrophoresis. Quantitation of DNA was performed using a Qubit 2.0 fluorometer (Life Technologies). Illumina paired-end sequencing libraries (read length, 2 × 250 bp) of genomic DNA were prepared using Nextera XT sample preparation kits (Illumina, Inc., San Diego, CA, USA) with dual indexing adapters. Illumina sequencing libraries were sequenced in-house using an Illumina MiSeq platform (Illumina, Inc., San Diego, CA, USA) and company-supplied paired-end sequencing kits. Adapter trimming was performed automatically by MiSeq control software (MCS), and additional adapter contamination identified by the NCBI server was removed by manual trimming. Raw reads were assembled de novo using CLC Genomics Workbench v7.5 (CLC bio, Aarhus, Denmark) with default settings. The quality of the genomes was accessed using CheckM v1.0.13 (36 (link)). Annotation was performed using the NCBI Prokaryotic Genome Annotation Pipeline (PGAP).

Illumina sequencing of the pooled RNA-seq libraries yielded 24 FASTQ files of sequences (PRJNA287523/SRP062637) with a total of 327.5 million reads passed the Illumina Casava pipeline 1.8 (Supplementary Table S3). The reads were aligned to the rRNA reference sequences obtained from the SILVA rRNA database (Quast et al., 2013 (link)) with the minimum sequence similarity of 0.95 and minimum length fraction of 1.0 to remove reads derived rRNA. The rRNA depleted reads of 307.9 million were then used for mapping against the improved apple reference transcriptome (Bai et al., 2014 (link)) using CLC Genomics Workbench v7.5 (CLCBio, Cambridge, MA, USA) with the following parameters: the minimum similarity fraction of 0.98, the minimum length fraction of 0.8, and the maximum number of hits of 10. Gene expression levels were calculated and normalized by reads per kilobase of exon model per million mapped reads (RPKM) (Mortazavi et al., 2008 (link)). Genes of RPKM>1.0 were defined to be expressed. For convenience, these novel transcripts in the improved reference transcriptome will be referred to ‘gene’ and named ‘G######’ as in ‘G101234’, and ‘MDP0000’ in the original gene IDs (e.g. MDP0000123456) will be abbreviated to ‘M’ (e.g. M123456) hereafter.