Total RNA was extracted using the TRizol reagent (Invitrogen) according to the manufacturer's instructions. RNA concentrations were determined using a NanoDrop spectrophotometer (Thermo Scientific). 1μg of RNA from each sample was treated with DNase I (Invitrogen), and transcribed into cDNA using the SuperScript III Reverse Transcriptase (Invitrogen). Quantitative real-time PCR (qPCR) was performed with SensiFAST SYBR No-ROX Kit (FroggaBio), using the CFX96 Real-Time System (Biorad). Thermocycling parameters were as follows: 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min, followed by a melting curve. Primers against the different genes of interest were designed using the PrimerQuest software from Integrated DNA Technologies (IDT). Primers were tested for performance in qPCR with a cDNA concentration gradient, and those with slopes between −3.3 and −3.7, efficiency of ∼1.0, and R2 of ∼1.0 were used in the qPCR studies (primer sequences used in the study are summarized in Table 1 ). The expression levels of the different targets in relation to the endogenous 16S rRNA gene control was determined by the 2−ΔΔCT method using the CFX Manager Software (Biorad). The relative quantification (RQ) values of all samples were normalized against the expression of the 16S control for each target.
Sensifast sybr no rox kit
Manufactured by FroggaBio
Sourced in Canada
The SensiFAST SYBR No-ROX Kit is a qPCR reagent used for real-time PCR amplification and detection of DNA sequences. It contains a SYBR Green-based master mix that does not require the use of a passive reference dye.
Automatically generated - may contain errors
Lab products found in correlation
Purelink rna mini kit, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Cfx manager software, by Bio-Rad (2 mentions)
Primerquest software, by Integrated DNA Technologies (2 mentions)
Rotor gene 6000, by Qiagen (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Chloroform, by Merck Group (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
5 protocols using sensifast sybr no rox kit
1
Quantitative RT-PCR Gene Expression Analysis
2
RNA Isolation and qPCR Analysis of Immune Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated by removing the media and adding Trizol (ThermoFisher, 15596-018) for 5 min at room temperature, followed by 150 μl chloroform (Sigma, C2432). After briefly vortexing and centrifuging at high speed, the nucleic acid phase was collected, precipitated with 100% isopropanol, washed with 70% ethanol and eluted in RNase-free water. Complementary DNA (cDNA) was then made from isolated RNA with the QuantiTect reverse transcription kit (Qiagen, 205313). qPCR was performed using the SensiFast SYBR No-Rox kit (Frogga Bio, BIO-98020) following manufacturer’s protocol and run on a Bio-Rad C1000 CFX3 thermocycler. qPCR primers against all utilized mouse and human immune gene CDS, as well as hOCT4, hSOX17, hFOXA2 and all used housekeeping genes are listed in Supplementary Table 2 .
3
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from bacterial cultures grown to the mid-logarithmic phase of growth was extracted using TRIzol reagent (Invitrogen), treated with DNase I (Invitrogen) and transcribed into cDNA using the SuperScript III Reverse Transcriptase (Invitrogen). Quantitative real-time PCR (qPCR) was performed with the SensiFAST SYBR No-ROX Kit (FroggaBio) using the CFX96 Real-Time System (Biorad). Thermocycling parameters were as follows: 95 °C for 2 min hot start, 40 cycles at 95 °C for 15 s, and 60 °C for 1 min followed by a melting curve. Primers to genes of interest were designed using PrimerQuest software from Integrated DNA Technologies (IDT). Primers were tested for performance in qPCR with a cDNA concentration gradient, and those with slopes between −3.3 and −3.7, the efficiency of ∼1.0 and R2 of ∼1.0 were used in the qPCR studies. All primers employed here are listed in Table 2 . Expression of tsiV1 relative to 16 s rRNA control was determined by the 2−ΔΔCT method using the CFX Manager Software (Biorad). The resulting relative quantification (RQ) values of all samples were normalised against expression of strain C6706.
4
Lentiviral Transduction of Jurkat Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Jurkat E6.1 cells were infected with various lentiviral vectors at equivalent infection rates based on EGFP fluorescence. RNA was collected from infected Jurkat E6.1 cells with the PureLink RNA minikit (Invitrogen) at 48 h postinfection and stored at −80°C. Purified RNA was reverse transcribed into bulk cDNA with the SuperScript III First-Strand Synthesis System. cDNA was used as a template for qRT-PCR with the SensiFAST SYBR No-ROX kit (FroggaBio, Toronto, ON, Canada) to amplify Env- and Nef-specific amplicons with the following primers: common Env and Nef fwd 5′-GGCGGCGACTGAAGAAG, Env rev 5′-ACTATGGACCACACAACTATTGCT, and Nef rev 5′-GATTGGGAGGtGGGTTGCT. qRT-PCR runs were performed with a Rotor-Gene 6000 (Qiagen, Valencia, CA) under the following conditions: 1 cycle of 95°C for 2 min for polymerase activation and 40 cycles of 95°C for 5 s for denaturation, 60°C for 10 s for annealing, and 72°C for 15 s for extension. Relative levels of Nef and Env mRNAs were calculated from standard curves generated from plasmids carrying the respective genes at known concentrations.
5
Quantification of HIV Nef and Env mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Jurkat E6.1 cells were infected with lentiviral vectors [33 (link)] encoding Nef NL4.3 or Nef from subtype G (FI.93.HH8793) or H (BE.93.VI997) reference strains. Forty-eight hours post infection, RNA was collected with the PureLink® RNA Mini Kit (Thermo Fisher Scientific). The cDNA was reverse-transcribed from the isolated messenger RNA (mRNA) with SuperScript® III First-Strand Synthesis System. The cDNA was used for qRT-PCR with a SensiFAST™ SYBR No-ROX Kit (FroggaBio) to amplify viral envelope protein (Env)-, Nef-, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH)-specific amplicons with the following primers: Env and Nef forward 5′–GGCGGCGACTGAAGAAG, Env reverse 5′–ACTATGGACCACACAACTATTGCT, Nef reverse 5′–GATTGGGAGGTGGGTTGCT, GAPDH forward 5′–ACAACTTTGGTATCGTGGAAGG, and GAPDH reverse 3′–GCCATCACGCCACAGTTTC. The qRT-PCR runs were performed on a Rotor-Gene 6000 (Qiagen, Valencia, CA, USA) as previously described [33 (link)]. The relative levels of Nef, Env, and GAPDH mRNA were calculated from standard curves generated from linearized plasmids encoding the respective genes at known concentrations. Statistical analysis comparing mRNA levels was completed with GraphPad Prism using a one-way Anova with Dunnett’s multiple comparisons test.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!