Lightcycler software version 3

Manufactured by Roche

Sourced in United States, Switzerland

The LightCycler software version 3.5 is a real-time PCR analysis software. It provides functions for the analysis and management of data generated by the LightCycler instrument.

Automatically generated - may contain errors

Lab products found in correlation

Lightcycler, by Roche (5 mentions) Lightcycler taqman master, by Roche (3 mentions) Lightcycler faststart dna master sybr green 1, by Roche (3 mentions) Lightcycler system, by Roche (2 mentions) Moloney murine leukemia virus reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Sybr green 1 kit, by Roche (2 mentions) Quantitect primer assay, by Qiagen (2 mentions) Quantifast sybrvr green rt pcr kit, by Qiagen (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Lightcycler faststart dna master syber green 1, by Roche (2 mentions) Miscript sybr green pcr kit, by Qiagen (2 mentions) Primescript rt master mix, by Takara Bio (2 mentions) Totally rna kit, by Thermo Fisher Scientific (1 mentions) Transcript first strand cdna synthesis kit, by Roche (1 mentions) Lightcycler faststart dna master sybr green 1 kit, by Roche (1 mentions) Miscript reverse transcription, by Qiagen (1 mentions) Allprep dna rna protein mini kit, by Qiagen (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Lightcycler 480 sybr green 1 master kit, by Roche (1 mentions) Primescript rt master mix perfect real time, by Takara Bio (1 mentions)

Spelling variants of this product

LightCycler (1119 citations) LightCycler software (129 citations) LightCycler Software 3.5 (12 citations) LightCycler 3.5 software (10 citations) LightCycler, version 3 (5 citations) LightCycler Relative Quantification Software, version 3.3 (5 citations)

27 protocols using lightcycler software version 3

Quantitative Analysis of Dopaminergic Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using a ToTALLY RNA kit (Ambion, Austin, TX, USA). One microgram of the RNA template was reverse-transcribed using a Transcript First Strand cDNA Synthesis kit (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's guidance. Subsequently, a 2 µL aliquot of each sample was subjected to real-time polymerase chain reaction (PCR) in a 20 µL reaction mixture containing 4 mM MgCl₂, 10 pmol of upstream and downstream primers, and 2 µL of 10X Light Cycler Fast Start DNA Master SYBR Green 1 (Roche Diagnostics). Data were analyzed with Light Cycler software version 3.5 (Roche Diagnostics). The following primer sets were chosen for real-time PCR analyses.
Glyceraldehyde 3-phosphate dehydrogenase: 5'-GTGTTCCTACCCCCAATGTG-3'; 5'-TGTGAGGGAGATG-CTCAGTG-3' (400 bp), Nurr1: 5'-CGGTTTCAGAAGTGCCTAGC-3'; 5'-CTGGGTTGGACCTGTATGCT-3' (420 bp), Pitx3: 5'-ACAAAGTGGAAC-CCCTATGAG-3'; 5'-TTCTTGGCCAATCTGTAGGA-3' (255 bp), tyrosine hydroxylase (TH): 5'-TTGGCTGACCGCACATTTG-3'; 5'-ACGAGAGGC-ATAGTTCCTGAGC-3' (336 bp), aromatic L-amino acid decarboxylase (AADC): 5'-AGAAGAGGCAAGGAGATGGTGG-3'; 5'-AAGCGAAGAAAT-AGGGAC-TCTGC-3' (214 bp), dopamine receptor 2 (D2R): 5'-CCTT-CATCGTCACCCTGCTGG-3'; 5'-CTCCATTTCCAGCTCCTGAG-3' (245 bp/158 bp).

Hwang M., Lee J.M., Kim Y, & Geum D. (2014). Functional Role of Parkin against Oxidative Stress in Neural Cells. Endocrinology and Metabolism, 29(1), 62-69.

+ Open protocol

+ Expand

RT-qPCR Assay for Cytokine Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

RealTime‐PCR was performed using LightCycler^® TaqMan^® Master (Roche) according to the manufacturer's instructions. Primers were designed using the Roche UniversalProbeLibrary Assay Design Centre (http://www.universalprobelibrary.com/): glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) (forward primer: 5′‐agccacatcgctcagacac‐3′, reverse primer: 5′‐gcccaatacgaccaaatcc‐3′, UPL probe #60; Amplicon Size [bp] 66) – IL‐33 (forward primer: 5′‐agcaaagtggaagaacacagc‐3′, reverse primer: 5′‐cttctttggccttctgttgg‐3′, UPL probe #33, Amplicon Size [bp] 74) – sST2 (forward primer: 5′‐gggagagatatgctacctggag‐3′, reverse primer: 5′‐ cgcctgctctttcgtatgtt‐3′, UPL probe #86, Amplicon Size [bp] 68) – ST2L (forward primer: 5′‐ gaaatacctgagactgggtgatttat 3′, reverse primer: 5′‐gaagtgcctgcctttgctt‐3′, UPL probe #29, Amplicon Size [bp] 149). The amplification conditions consisted of an initial incubation at 95°C for 10 minutes, followed by 45 cycles of 95°C for 10 seconds, 63°C for 20 seconds and 72°C for 6 seconds and a final cooling to 4°C. Data were analyzed using LightCycler Software Version 3.5 (Roche).

Pentz R., Kaun C., Thaler B., Stojkovic S., Lenz M., Krychtiuk K.A., Zuckermann A., Huber K., Wojta J., Hohensinner P.J, & Demyanets S. (2018). Cardioprotective cytokine interleukin‐33 is up‐regulated by statins in human cardiac tissue. Journal of Cellular and Molecular Medicine, 22(12), 6122-6133.

+ Open protocol

+ Expand

Quantitative detection of pmoA gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

qPCR targeting the pmoA gene using primers A189 and A682 (Holmes et al., 1995 (link)) was performed with a LightCycler FastStart DNA Master SYBR green I kit (Roche Molecular Biochemicals, Indianapolis, IN) and the LightCycler system (Roche Applied Science, Indianapolis, IN) as described previously (Yoshida et al., 2009 (link)). The PCR profile consisted of preheating at 95°C for 10 min and 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 10 s, and extension at 72°C for 20 s. The fluorescence signal was detected at 72°C during each cycle, and a melting curve was obtained by heating the product to 95°C and cooling it to 40°C. The calibration curves were graphed and the copy numbers of pmoA were calculated with LightCycler software version 3.5 (Roche Diagnostics) using serial dilutions of the pmoA amplicons from Methylococcus capsulatus Bath as a standard. The PCR efficiency was 90%, which was calculated from qPCR using serially diluted standard samples prepared from the pmoA amplicons of Methylococcus capsulatus Bath. Melting curve analyses demonstrated the absence of primer dimer formation and non-specific amplifications in all samples facilitating the use of 72°C as temperature of recording fluorescence.

Yoshida N., Iguchi H., Yurimoto H., Murakami A, & Sakai Y. (2014). Aquatic plant surface as a niche for methanotrophs. Frontiers in Microbiology, 5, 30.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of RNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cultured OC cells using AllPrep DNA/RNA/Protein Mini kit (Qiagen) following manufacturer’s protocol and the quantity and quality determined by absorbance (260, 280nm). Total RNA (2 µg) was reverse transcribed with the LightCycler 480 SYBR Green I Master kit (Roche, Switzerland) and analyzed by qRT-PCR according to the manufacturer’s instructions. Primer sequences (Fisher Scientific) can be found in Supplementary Table S1. For in vivo qRT-PCR validation assay, the RNA was isolated from tumor tissues using TRizol® reagent (Invitrogen, CA) according to the manufacturer’s instruction. qRT-PCR was performed using miScript reverse transcription and miScript SYBR^® Green PCR kits (Qiagen, CA) in a Roche Lightcycler (Roche Applied Science, IN), as described previously (14 (link), 22 (link)). mRNA expression level was determined using LightCycler software version 3.5 (Roche Applied Science, IN), normalized to EEF1α1b, and using the 2^−ΔΔCT method of relative quantification.

Fang F., Munck J., Tang J., Taverna P., Wang Y., Miller D.F., Pilrose J., Choy G., Azab M., Pawelczak K.S., VanderVere-Carozza P., Wagner M., Lyons J., Matei D., Turchi J.J, & Nephew K.P. (2014). The novel, small molecule DNA methylation inhibitor SGI-110 as an ovarian cancer chemosensitizer. Clinical cancer research : an official journal of the American Association for Cancer Research, 20(24), 6504-6516.

+ Open protocol

+ Expand

Quantitative PCR Analysis of CDCs

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of CDCs was isolated using RNAeasy Mini Kit (QIAGEN). The extracted total RNA was reverse-transcribed into single-stranded cDNA using PrimeScript RT Master Mix (Perfect Real Time) kit (Takara Bio). Real-time PCR was performed using cDNA with QuantiTect SYBR Green PCR Kit (QIAGEN). Primer sequences are listed in Supplementary Table S1 32 (link)33 (link)34 (link)35 (link)36 (link)37 (link)38 (link)39 (link)40 (link). The reaction condition was 95 °C for 15 min, and followed by 48 cycles of the following reaction: 95 °C for 10 s and 60 °C for 30 s. The quantitative PCR was performed with LightCycler software version 3.5 (Roche Applied Science) and data were evaluated using the 2^−ΔΔCT method.

Nakamura T., Hosoyama T., Kawamura D., Takeuchi Y., Tanaka Y., Samura M., Ueno K., Nishimoto A., Kurazumi H., Suzuki R., Ito H., Sakata K., Mikamo A., Li T.S, & Hamano K. (2016). Influence of aging on the quantity and quality of human cardiac stem cells. Scientific Reports, 6, 22781.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the pancreatic cells by using Trizol reagent according to the manufacturer’s instructions. Reverse transcription was conducted with Primescript RT reagent kit. Real time PCR was performed on an ABI 7500 sequence detection system (Applied Biosystems, Thermo Fisher Scientific) using SYBR Premix EX Taq. The amplification conditions were as follows: 95°C, 10 minutes; then followed by 45 cycles (95°C, 10 seconds; 60°C, 10 seconds; 72°C, 15 seconds); finally, 95°C, 15 seconds; 60°C, 1 hour; 95°C, 15 seconds. The relative expression level of related genes was normalized to that of GAPDH in the same sample by using LightCycler Software Version 3.5 (Roche Applied Science, Hoffman-La Roche Ltd., Basel, Switzerland).

Zhang L., Lv Y., Rong Y., Chen W., Fang Y., Mao W., Lou W., Jin D, & Xu X. (2019). Downregulated expression of RACK1 results in pancreatic cancer growth and metastasis. OncoTargets and therapy, 12, 1007-1020.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

H9c2 cells cultured in 10% FCS were incubated, and total RNAs were purified by the acid guanidinium thiocyanate-phenol-chloroform extraction method. One µg total RNA was mixed with random hexanucleotides and 200 units of Moloney murine leukemia virus reverse transcriptase (Invitrogen Corp., Carlsbad, CA, USA) for first-strand cDNA synthesis. Using the SYBR Green I kit and a LightCycler (Roche Diagnostics, Mannheim, Germany), precipitated cDNA was quantified by real-time PCR using the following primers: forward primer (5′-CGAGTCCCAGGTCAACAA-3′) and reverse primer (5′-GGCTTCACAGGCATCCTTA-3′). The cDNA for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was also amplified with the forward primer (5′-TGAACGGGAAGCTCACTGG-3′) and reverse primer (5′-TCCACCACCCTGTTGGCTGTA-3′). The thermal cycling conditions were 10 min at 95°C, followed by 50 cycles of 10 sec at 95°C for denaturing, 10 sec at 62°C for annealing, and 7 sec at 72°C for extension. PCR signals were analyzed using LightCycler software version 3.5 (Roche Diagnostics).

Iwaki H., Sasaki S., Matsushita A., Ohba K., Matsunaga H., Misawa H., Oki Y., Ishizuka K., Nakamura H, & Suda T. (2014). Essential Role of TEA Domain Transcription Factors in the Negative Regulation of the MYH 7 Gene by Thyroid Hormone and Its Receptors. PLoS ONE, 9(4), e88610.

+ Open protocol

+ Expand

RNA Extraction and Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA of tissues was extracted using the RNAprep Pure Tissue Kit (Tiangen Biotech, Beijing, China). Reverse transcription was conducted using the PrimeScript RT Master Mix (Takara Bio, Dalian, China). Real-time PCR was performed using the ChamQTM SYBR qPCR Master Mix (Takara) and Roche Molecular Biochemicals LightCycler Software version 3.5 (Roche, Nutley, USA). Primer sets for murine genes are listed in Supplementary Table 2.

Xiao Y., Tian J., Wu W.C., Gao Y.H., Guo Y.X., Song S.J., Gao R., Wang L.B., Wu X.Y., Zhang Y, & Li X. (2021). Targeting central nervous system extracellular vesicles enhanced triiodothyronine remyelination effect on experimental autoimmune encephalomyelitis. Bioactive Materials, 9, 373-384.

+ Open protocol

+ Expand

Quantification of HOTAIR Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cultured cells using RNeasy mini kit (Qiagen, 74104) following manufacturer’s protocol. Concentrations were determined by using the absorbance at 260 nm, and purity was assessed based on the 260/280 nm absorbance ratio. Total RNA (2μg) was reverse transcribed with the following manufacturer’s instructions. qPCR was performed using Lightcycler 480 SYBER Green I Master kit (Roche Diagnostics, cat #04707516001) and HOTAIR (Forward primer 5’-GTGGTTTATCTTGCACCCCTCATTCTCAAGCCCCAGCCAGGGAA-3’, and reverse primer 5’-TTCCCTGGCTGGGGCTTGAGAATGAGGGGTGCAAGATAAACCAC-3’. mRNA expression levels were determined using Lightcycler software version 3.5 (Roche Applied Science) and normalized to EEF1A1: Forward primer: 5’-GCCCCAGGACACAGAGACTTTATC-3’;Reverse primer: 5’-CAACACCAGCAACAATCAG-3’).

Wang W., Fang F., Ozes A, & Nephew K.P. (2021). Targeting Ovarian Cancer Stem Cells by Dual Inhibition of HOTAIR and DNA Methylation. Molecular cancer therapeutics, 20(6), 1092-1101.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cultured cells using TRI reagent (Ambion, Foster City, CA). The cDNA was reversely transcribed using random hexamers from 1 μg of total RNA using Transcription Reverse Transcriptase (Roche Applied Science) as per manufacturer’s instructions. The cDNA generated was used for qRT-PCR amplification using the LightCycler FastStart DNA Master ^PLUS SYBR Green I Kit (Roche Applied Science). The reaction was carried in the Light Cycler instrument (Roche Applied Science) and the PCR reaction was subjected to a melting curve analysis to verify the presence of a single amplicon using the Roche Molecular Biochemicals LightCycler Software (version 3.5). The mRNA levels were normalized to human cyclophilin expression level. Primer information is provided in (S1 Table) and the 2^-ΔΔCT relative quantification method was used to calculate the mean fold expression difference between the groups.

Chang E.Y., Chang Y.C., Shun C.T., Tien Y.W., Tsai S.H., Hee S.W., Chen I.J, & Chuang L.M. (2016). Inhibition of Prostaglandin Reductase 2, a Putative Oncogene Overexpressed in Human Pancreatic Adenocarcinoma, Induces Oxidative Stress-Mediated Cell Death Involving xCT and CTH Gene Expressions through 15-Keto-PGE2. PLoS ONE, 11(1), e0147390.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!