Bacterial dna isolation kit

Genomic DNA was extracted from the intestinal bacteria using a bacterial DNA isolation kit (Foregene, Chengdu, China) according to the manufacturer’s instructions. The extracted DNA was checked on 1% agarose gel, and DNA concentration and purity were determined with NanoDrop 2000 UV-vis spectrophotometer (Thermo Scientific, Wilmington, DE, USA). After the extraction, DNA fragments from the samples were amplified using specific primers: 338F: 5′-ACTCCTACGGGAGGCAGCAG-3′, 806R: 5′-GGACTACHVGGGTWTCTAAT-3′ [61 (link)]. The PCR product was detected using 2% agarose gel, purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) and quantified using Quantus™ Fluorometer (Promega, Madison, WI, USA). V3–V4 amplicon library was constructed using TruSeqTM DNA Sample Prep Kit (Illumina, San Diego, CA, USA). High-throughput sequencing was performed in a paired-end model using the Illumina MiSeq PE300 platform (Illumina, San Diego, CA, USA) by Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China).

The genomic DNA from the hybrid elephant grass silage was extracted using the bacterial DNA isolation kit (DE-05311, Foregene, Chengdu, China). DNA concentration and purity were detected by NanoDrop2000C, with the optical density set at 260/280 nm (Yan et al., 2019 (link)). Qualified DNA samples were used for subsequent analysis. The 16S rRNA genes of distinct regions (V3–V4) were amplified by PCR with the primers 341F (5'-CCTAYGGGRBGCASCAG-3') and 806R (5'-GGACTACNNGGGTATCTAAT-3'). Qualified PCR products were selected using agarose gel electrophoresis at 2% concentration, and then the target bands were recovered by the gel extraction kit (Qiagen, Germany). Finally, libraries were constructed, and qualified libraries were sequenced on the platform of Illumina NovaSeq6000.

Samples of intestinal contents were collected using a bacterial DNA isolation kit (Foregene, Chengdu, China), and each DNA sample was tested for quality and integrity using a 1% agarose gel. PCR amplification of the variable regions V3 to V4 was performed using primers 338-F (5′ ACTCCTACGGGAGGCAGCAG 3′) and 806-R (5′ GGACTACHVGGGTWTCTAAT 3′). The PCR products were mixed in equal amounts according to the PCR product concentrations, and after sufficient mixing, the PCR products were detected by agarose gel electrophoresis with a mass fraction of 2%, and the target bands were subjected to gel recovery using the QIAquick Gel Extraction Kit (Qiagen, Germany). Quantification was performed using QuantiFluorTM-ST Blue Fluorescence System (Promega, Beijing, China). Sequencing libraries were constructed and high-throughput sequencing was performed on the purified samples. The raw data were spliced using FLASH software (version 1.2.11), the spliced sequences were quality filtered by Trimmomatic software (version 0.33), UCHIME software (version 8.1) identifies and removes chimeras. Clustering was performed using USEARCH (version 10.0) at a 97% similarity level to obtain operational taxonomic units (OTUs). Microbial diversity analysis was performed based on the MegiCloud platform to obtain α-diversity index, β-diversity, species annotation and taxonomic analysis.