Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) fractionated antigen samples were transferred to a polyvinylidene difluoride membrane (Carl Roth, Karlsruhe, Germany). The membrane was blocked with phosphate buffered saline (PBS) containing 2% powdered milk. Then membrane was incubated with purified MAbs (0.2 µg/mL) or allergic patients’ sera diluted 1:50 in PBS with Tween-20 (PBS-T) with 2% powdered milk for 1 h at RT. Next, the membrane was incubated with antibody conjugates (goat anti-mouse IgG (H+L)-HRP (Bio-Rad, Hercules, CA, USA, catalogue number #1721011), or mouse anti-human IgE Fc-HRP (SouthernBiotech, Birmingham, AL, USA, catalogue number #9160-05)) 1:4000 and 1:1000 dilution respectively in PBS-T with 2% powdered milk for 1 h at RT. 1-Step™ Tetramethylbenzidine (TMB)-Blotting Substrate Solution (Thermo Fisher Scientific, Waltham, MA, USA) was used and the enzymatic reaction was stopped by washing the membrane with water.
Goat anti mouse igg h l hrp
Manufactured by Bio-Rad
Sourced in United States
Goat anti-mouse IgG (H+L)-HRP is a secondary antibody conjugated with horseradish peroxidase (HRP). It is designed to detect and bind to mouse immunoglobulin G (IgG) molecules, recognizing both the heavy and light chains.
Automatically generated - may contain errors
Lab products found in correlation
Goat anti rabbit igg h l hrp, by Bio-Rad (8 mentions)
Goat anti rabbit igg h l horseradish peroxidase hrp, by Bio-Rad (3 mentions)
Trans blot turbo transfer system, by Bio-Rad (2 mentions)
Rela p65, by Cell Signaling Technology (2 mentions)
Gapdh, by Santa Cruz Biotechnology (2 mentions)
α catenin, by Merck Group (2 mentions)
α tubulin, by Merck Group (2 mentions)
Phospho p38, by Cell Signaling Technology (2 mentions)
Phospho hsp27, by Cell Signaling Technology (2 mentions)
Phospho smad2, by Cell Signaling Technology (2 mentions)
Flag tag (flag), by Merck Group (2 mentions)
Goat anti rabbit igg h l hrp conjugate, by Bio-Rad (2 mentions)
Polyvinylidene difluoride membrane, by Carl Roth (1 mentions)
Mouse anti human ige fc hrp, by Southern Biotech (1 mentions)
Enzyme activity kit, by Nanjing Jiancheng (1 mentions)
Hoechst 33342 b2261, by Merck Group (1 mentions)
Percp cy5, by BioLegend (1 mentions)
Alexa fluor 488 phalloidin, by Thermo Fisher Scientific (1 mentions)
P ampk, by Abcam (1 mentions)
Cd105, by BioLegend (1 mentions)
18 protocols using goat anti mouse igg h l hrp
1
SDS-PAGE Antigen Immunoblotting Protocol
2
Metabolic Profiling of Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hexokinase (HK), pyruvate kinase (PK), lactate dehydrogenase (LDH), and alkaline phosphatase (ALP) enzyme activity kits were obtained from Jiancheng (Nanjing, China). MitoTracker Red CMXRos (M7512) and Alexa Fluor 488 Phalloidin (A12379) were obtained from Invitrogen (Carlsbad, CA, USA). The XF Cell Energy Phenotype Test Kit, XFp extracellular flux analyzer, XFp culture microplates, and bicarbonate-free DMEM were obtained from Seahorse Bioscience Agilent Technologies (North Billerica, MA, USA). Hoechst 33342 (B2261) and carbonyl cyanide 3-chlorophenylhydrazone (CCCP, C2759) were purchased from Sigma–Aldrich (St Louis, MO, USA). The following antibodies were used: CD90 (FITC, mouse anti-human, BioLegend, 328107), CD105 (PerCP/Cy5.5, mouse anti-human, BioLegend, 323215), CD19 (PE, mouse anti-human, BioLegend, 982402), CD34 (PE, mouse anti-human, BioLegend, 343505), AMPK (Abcam, ab80039), p-AMPK (Abcam, ab133448), anti-GAPDH (Abcam, ab9485,ab8245), goat anti-rabbit IgG (H + L)-HRP (Bio-Rad Laboratories, 1706515), goat anti-mouse IgG (H + L)-HRP (Bio-Rad Laboratories,1706516) and goat anti-rabbit IgG (H+L) Alexa Fluor 594-conjugated secondary antibody (Invitrogen, R37117).
3
Investigating Pro-Inflammatory Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RPMI-1640, DMEM, blasticidin, penicillin, streptomycin, Ficoll-Hypaque, sodium citrate, LPS from Escherichia coli O55:B5 applied without repurification, hrGGT, BAY-11-7082 (BAY), TF, TNFα, and β-actin were purchased from Sigma-Aldrich, Milan, Italy. An hrGGT stock (Abnova, Taipei City, Taiwan) was prepared at 10 ng/mL in endotoxin-free water. A human anti-TF antibody (epitope specific for aa 1–25) and relipidated full-length recombinant human TF were obtained from BioMedica Diagnostics, Windsor, NS, Canada. Mini-PROTEAN TGX Gel, Precision Plus Protein All Blue, Trans-Blot Turbo transfer system, Opti-4CN substrate Kit, Goat Anti-Rabbit IgG H&L (HRP), and Goat Anti-Mouse IgG H&L (HRP) were obtained from Bio-Rad, Hercules, CA, USA. Ultrapure LPS-RS, CLI-095 (CLI), HEK293 human (h)TLR4-positive (HEK-Blue hTLR4), and negative (HEK-Blue Null2) cell lines were purchased from InvivoGen, Toulose, France. A GGT-1-purified MaxPab mouse polyclonal antibody (B01P) was purchased from Abnova, Taipei City, Taiwan. An LAL chromogenic endpoint assay was obtained from Hycult Biotech, Uden, The Netherlands.
4
Western Blot Analysis of Cell Membrane Microdomains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell membrane microdomains were confirmed using a Western blot analysis. A total of 150 µL of each fraction was precipitated using the methanol–isopropanol–water method [24 (link)], and the protein pellets were dissolved in 50 µL of 1x NuPAGE™ LDS Sample Buffer (Invitrogen, Carlsbad, CA, USA). A total of 20 µL of the protein solution was separated using SDS-PAGE, and gels were transferred to a PVDF membrane (Biorad, Hercules, CA, USA). The PVDF membrane was blocked via incubation with 5% nonfat powdered milk. The PVDF strips were incubated for 1 h (or overnight at 4 °C) at room temperature with a primary antibody (anti-flotillin-1 (Cell Signaling Technology Inc., Danvers, MA, USA) (1:1000), anti-Prohibitins PBH1 (Cell Signaling Technology Inc. Danvers, MA, USA) (1:5000) or anti-Calnexin (BD Biosciences, San Jose, CA, USA)(1:250)); washed; and then incubated with the horseradish peroxidase conjugated secondary antibody (Goat Anti-Rabbit IgG (H + L)-HRP, (Biorad, Hercules, CA, USA), dilution (1:3000) or Goat Anti-Mouse IgG (H + L)-HRP, (Biorad, Hercules, CA, USA), dilution (1:2000)). After washing, antibodies were detected using chemiluminescence with the West Pico PLUS Chemiluminescent-Substrat (Thermo Fischer Scientific, Waltham, MA, USA).
5
Protein Expression Analysis of MDSCs and MVs
6
Inhibitors and Antibodies for Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Inhibitors CAY10657 (Cat# 11140, CAS № 494772-86-0) and 5Z-7-oxozeaenol,Ox1, (Cat# 17459, CAS № 253863-19-3), and U0126 (Cat#70970) were obtained from Cayman Chemical (Ann Arbor, Michigan); 5Z-7-oxozeaenol, Ox2, (Cat#3604) was obtained from Tocris Bio-Techne (Minneapolis, MN); BMS-345541 (Cat#A3248), CX-5461 (Cat# A8337), Birinapant TL-32711 were from APExBio (Houston, TX); SB202190 (Cat# 559388) was from Calbiochem (EMD Millipore; Billerica, MA); Nutlin 3A (Cat# SML0580) was obtained from Sigma Aldrich (Atlanta, GA). Antibodies for: GAPDH (Cat# sc-25778), Fibrillarin (Cat# sc-25397), and IκBα (Cat# sc-371) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); RELA/p65 (Cat# 8242) and phospho-p65/RELA (Ser536) (Cat#3033); phospho-p53 (Ser15) (Cat# 9284) were from Cell Signaling Technology (Danvers, MA); α-Tubulin (Cat# T6074), Goat anti-Rabbit IgG (H + L)-Horseradish Peroxidase (HRP) (Cat# 170–6515) and goat anti-Mouse IgG (H + L)-HRP (CAT# 170–6516) secondary antibodies were from BIO-RAD Laboratories (Hercules, CA).
7
TGF-β1 and TNFα Signaling Pathway Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant human TGF-β1 (Cat# 240-B/CF) was obtained from R&D Systems (Minneapolis, MN); recombinant human TNFα (Cat# CYT-223) was from ProSpec-Tany TechnoGene Ltd (Rehovot, Isreal). Antibodies for: GAPDH (Cat# sc-25778), p38MAPK(sc-81621) and IκBα (Cat# sc-371) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); phospho-Smad2 (Cat# 3108), phospho-HSP27 (Cat# 2401), phospho-p38 (Cat# 9211), RELA/p65 (Cat# 8242) and ICAM1 (Cat# 4915) were from Cell Signaling Technology (Danvers, MA); α-Tubulin (Cat# T6074), α-Catenin (Cat# C2081) and FLAG (Cat# F3165) were from Sigma-Aldrich (St. Louis, MO); FN1 (Cat# 610077) and Smad2 (Cat# 610842) were from BD Biosciences (San Jose, CA). Goat anti-Rabbit IgG (H+L)-Horseradish Peroxidase (HRP) (Cat# 170-6515) and goat anti-Mouse IgG (H+L)-HRP (CAT# 170-6516) secondary antibodies were from BIO-RAD Laboratories (Hercules, CA). Inhibitor of p38, SB202190 (Cat# 559388) was obtained from Calbiochem (EMD Millipore; Billerica, MA). Retroviral constructs encoding EGFP, FLAG-p38MAPK-AGF and HA-MKK6-AL are described in [24 (link)]. Short interfering RNA (siRNA) to human p38-alpha (MAPK14; Cat # 1299001; VHS40416; sequence CCAAAUUCUCCGAGGUCUAAAGUAU) was from Thermo Fisher Scientific (Waltham, MA).
8
Western Blot Analysis of Prostate Cancer Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein was extracted from PCa cells using RIPA lysis buffer (Beyotime Institute of Biotechnology) and the concentration of protein was determined using a BCA Protein Assay kit (Beyotime Institute of Biotechnology). The samples (50 µg per lane) were separated by 8 or 10% SDS-PAGE and then transferred onto PVDF membranes (EMD Millipore). After blocking with TBST containing 5% skim milk at room temperature for 1 h, the membranes were incubated overnight at 4°C with the following primary antibodies as appropriate: GGNBP2 (1:250; cat. no. ab203104, Sigma-Aldrich; Merck KGaA); cdc2 (cat. no. 9116), cyclin B1 (cat. no. 12231), β-catenin (cat. no. 9562), MMP-2 (cat. no. 4022) and β-actin (cat. no. 4970) (all 1:1,000; all from Cell Signaling Technology, Inc.); cdc25kC (1:500; cat. no. sc-13138; Santa Cruz Biotechnology, Inc.); E-cadherin (cat. no. 1702–1) and vimentin (cat. no. 2862-1) (1:1,000; both from Epitomics, Inc.); and heparanase (1;500; cat. no. ab42817; Abcam). Goat anti-rabbit IgG (H + L)-HRP and goat anti-mouse IgG (H + L)-HRP (1:3,000; Bio-Rad Laboratories, Inc.) were used as secondary antibodies and incubated with the membrane at room temperature for 2 h. Protein bands were visualized using Clarity™ Western ECL Substrate (Bio-Rad Laboratories, Inc.) (18 (link)).
9
Western Blot Protein Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteins were extracted from the lysed cells with a Mem-PER Plus membrane protein extraction kit (Thermo Fisher Scientific, catalog no. 89842). Trans-Blot Turbo (Bio-Rad) was used to transfer proteins from 8% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gel to a polyvinylidene difluoride Western blot membrane. The transferred membrane was incubated with 3% BSA and then with the primary antibodies at 4 °C overnight, including phospho-β-catenin-Ser675 (ABclonal, catalog no. AP0795), phospho-myosin light chain 2 (Ser19) (Cell Signaling, catalog no.3671), β-catenin (ABclonal, catalog no. A0316), tubulin (Abcam, catalog no. ab7291), APC (Abcam, catalog no. ab40778), Oct4 (Abcam, catalog no. ab181557), and Bmi1 (Abcam, catalog no. ab126783). The membrane was washed and incubated with the secondary antibodies, goat anti-mouse IgG (H+L)-HRP (horseradish peroxidase) conjugate and goat anti-rabbit IgG (H+L)-HRP conjugate (Bio-Rad, catalog no. 1706516), for 2 h. GAPDH (Abcam) was used for reference. The membranes were then incubated with Clarity and Clarity Max Western ECL Blotting Substrates (Thermo Fisher Scientific). Images were captured using the ChemiDoc Imaging system (Thermo Fisher Scientific).
10
Antibody Validation for Western Blot and ICC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary antibodies used for western blotting (WB) or immunocytochemistry (ICC) are as follows: mouse anti-FLAG (Sigma-Aldrich F1804, WB 1:3000), mouse anti-G3BP (Abcam ab56574, ICC 1:600), rabbit anti-HA (Abcam ab9110, WB 1:4000, ICC 1:300), mouse anti-tGFP (OriGene TA150041, WB: 1:1000), mouse anti-GAPDH (Santa Cruz Biotechnology sc32233, WB: 1:1000), mouse anti-FUS (Santa Cruz Biotechnology sc47711, WB: 1:1000), mouse anti-PSF (Santa Cruz Biotechnology sc374502, WB: 1:1000), rabbit anti-mono-methyl arginine (Cell Signaling Technology 8015, WB: 1:1000), and rabbit anti-dimethyl arginine, asymmetric (EMD Millipore 07-414, WB: 1:1000). Secondary antibodies used for western blotting or immunocytochemistry are as follows: goat anti-rabbit IgG (H+L)-HRP (Bio-Rad 1706515, WB 1:2000), goat anti-mouse IgG (H+L)-HRP (Bio-Rad 1706516, WB 1:2000), goat anti-rabbit IgG (H+L)-AlexaFluor488 (Jackson ImmunoResearch 111-545-144, ICC 1:200), goat anti-rabbit IgG (H+L)-Cy5 (Jackson ImmunoResearch 111-175-144, ICC 1:200), goat anti-mouse IgG (H+L)-AlexaFluor488 (Jackson ImmunoResearch 115-545-146, ICC 1:200), and goat anti-mouse IgG (H+L)-Cy5 (Jackson ImmunoResearch 115-175-146, ICC 1:200).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!