Total exosomal RNA (including miRNAs) were extracted using the TRIzol LS reagent (Invitrogen) according to the manufacturer's instructions. Total RNA quality and concentration were estimated by gel electrophoresis and a spectrophotometry (Thermo, Waltham, MA, USA). Reverse transcriptions of microRNAs were performed using a commercial kit (TaKaRa, China), according to the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR) of miRNAs were performed using a SYBR Premix Ex Taq kit (TaKaRa, China) on a Bio-RAD IQTM5 system (Bio-Rad, Hercules, CA, USA). The amplification conditions were as follows: initial denaturation at 95 ºC for 30 s, followed by 40 cycles of denaturation at 95 ºC for 30 s, annealing at 60 ºC for 40 s, and extension at 72 ºC for 30 s. The forward primer of miRNAs was identical in sequence and length to the miRNA itself (i.e., the most abundant isomiR) based on our sequencing results. The expression levels of individual miRNAs were normalized to miRNA U6. Relative expression of miRNAs was calculated via the 2-ΔΔCt method.
Iqtm5 system
Manufactured by Bio-Rad
Sourced in United States, China
The IQ5 system is a real-time PCR detection system designed for precise, sensitive, and reliable nucleic acid quantification. It features a high-performance optical system, advanced thermal control, and intuitive software for efficient experimental setup and data analysis.
Automatically generated - may contain errors
Lab products found in correlation
Reverse transcription kit, by Takara Bio (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Sybr green kit, by Takara Bio (2 mentions)
Trizol reagent, by Takara Bio (2 mentions)
Sybr premix ex taq kit, by Takara Bio (1 mentions)
Trizol ls reagent, by Thermo Fisher Scientific (1 mentions)
All in one rt mastermix kit, by Applied Biological Materials (1 mentions)
Nucleospin rna, by Macherey-Nagel (1 mentions)
Iscript rt supermix, by Bio-Rad (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Primerscriptrt reagent, by Takara Bio (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Sas 8, by SAS Institute (1 mentions)
Reverse transcription system, by Takara Bio (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Turbo dna free, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (1 mentions)
Sybrgreen kits, by Bio-Rad (1 mentions)
Trnzol a reagent, by Tiangen Biotech (1 mentions)
Sybr green mix, by Bio-Rad (1 mentions)
14 protocols using iqtm5 system
1
Exosomal miRNA Quantification Protocol
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from the gastrocnemius muscle according to the manufacturer's instructions. 5X All-In-One RT MasterMix Kit (Abm, Vancouver, Canada) was used to reverse transcribe RNA into DNA. The Bio-Rad iQTM5 system (Bio-Rad, Mississauga, Canada) was used to perform quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and the qRT-PCR data was analyzed by 2–ΔΔCt method (Livak Method). Mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was the reference gene in this experiment, and the gene primer sequences are listed in Table 2
3
Tissue-Specific Expression Analysis of AsCOI1 in A. sinensis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tissue-specific expression in roots, stems, leaves and branches of four-year-old A. sinensis plants as well as the AsCOI1expression pattern analysis induced by MeJA, mechanical wounding and heat were analyzed using the qRT–PCR method as described previously28 (link). Briefly, gene-specific forward and reverse primers were designed and synthesized (Table 1 ). About 15 ng cDNA reversely transcribed from total RNA was used as a template in a 25 mL volume. Tubulin (TUA) was used as a reference gene34 (link). qRT–PCR was carried out in triplicates for each biological sample using the BIORAD iQTM5 system (Bio-Rad). Three fully independent biological replicates were performed. The amplification specificity was assessed by dissociation curve analysis. Gene expression levels were determined using the 2−△△Ct method, where Ct represents the threshold cycle35 (link). Relative amount of transcripts was calculated and normalized as described previously35 (link). The average Cts were log transformed, mean centered and autoscaled36 (link). Standard deviations of the mean value from three biological replicates were calculated as described previously36 (link).
4
qPCR Analysis of Muscle and Adipose Cell Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The different expressions of si-RNA and regulating factors during cell proliferation and differentiation were detected using the qPCR method. Cyclin-dependent kinase inhibitor (P21), antigen identified by monoclonal antibody Ki 67 (KI67), muscle creatine kinase (MCK), myogenin (MYOG) and class I myosin (MYOD) were selected as regulator factors in muscle cell proliferation and differentiation. Cyclin D1, cyclin dependent kinase 4 (CDK4), peroxisome proliferator-activated receptor gamma (PPARγ) and fatty acid binding protein 4 (FABP4) were selected as regulating factors in adipose proliferation and differentiation. The total RNA of the harvest cells was extracted using Trizol® reagent. The reverse transcription of RNA into single-stranded DNA was performed using a reverse transcription kit. Real-time quantitative PCR was performed using a SYBR® green kit (TaKaRa Bio) on a Bio-Rad IQTM5 system (Bio-Rad, Hercules, CA, USA). GAPDH was used as an internal reference, and the expression level of the gene was calculated by 2−△△CT. The primers of the remaining genes are shown in Table 1 .
5
Quantifying GPX4 Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from different cells with a Fastgen2000 RNA isolation system (Fastgen, Shanghai, China) according to the manufacturer’s protocol. Complementary DNA was synthesized using reverse transcription kits (TaKaRa). Quantitative real-time RT–PCR (qRT–PCR) was performed with a Bio-Rad iQTM5 system (Bio-Rad). The 2−ΔΔCt method was used to analyse qRT–PCR data. The information of primers was listed below: GPX4-F: CAGTGAGGCAAGACCGAAGT; GPX4-R: GGGGCAGGTCCTTCTCTATC.
6
Quantifying NTN1 Gene Dosage and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect the gene dose of NTN1 in individuals with different IMF and NTN1 RNA expression in different tissues, real-time quantitative PCR amplification was performed using a SYBR® green kit (TaKaRa Bio, Shiga Prefectur, Japan) on a Bio-Rad IQTM5 system (Bio-Rad, Hercules, CA, USA). When detecting the gene dose of NTN1, the glucagon gene (GCG) was used as a single copy control. The copy number was calculated by the method of 2−ΔΔCT, where Δ CT was the differential value of the target region cycle threshold (CT) and of the control region CT. Moreover, 2−ΔΔCT stands for the comparison of the Δ CT value of samples with CNV to those without CNV. When detecting the NTN1 RNA expression in different tissues, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference, and the expression level of the gene was also calculated by 2−△△CT. A list of primer sequences is shown in Table 1 .
7
Isolation and Quantification of Gene Expression from Diverse Tissue Sources
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from tumors, cultured cells, plugs of Matrigel® and retinas were isolated using NucleoSpin® RNA (Ref. 740955; Macherey-Nagel) according to manufacturer’s instructions. RNA from sprouts of aortic rings was extracted using NucleoSpin® RNA XS (Ref. 740.902; Macherey–Nagel). In samples with high-Matrigel® content (plugs and sprouts) manufacturer’s instructions for fibrous tissues were followed. cDNA synthesis was performed with iScript RT Supermix (Ref. 1708841; Bio-Rad). cDNA from sprouts and plugs was preamplified with ssoAdvanced PreAmp Supermix (Ref. 1s725160; Bio-Rad) and Prime PCR Preamp Assays 2× (Bio-Rad), listed in Supplementary Table 1. For qPCR, Supermix iQTM SYBR® Green (Ref. 170–8882; Bio-Rad) and an iQTM 5 System (Bio-Rad) were used. Gene expression results were normalized to ribosomal protein S13 (Rps13) and β-actin (Actb) for mouse genes, to glycealdehyde-3-phosphate dehydrogenase (Gapdh) for human genes and to EC markers when we approximated the gene expression to EC content within the tissue. The primers used are listed in Supplementary Tables 1 and 2.
8
Gene Expression Analysis of Osteogenic Differentiation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were added to a 24-well plate; 3.5 × 104 cells were dispensed onto each sample and cultured for 7, 14 and 21 days. Cells on each disc were lysed with Trizol reagent (Invitrogen, USA) and the lysates were collected by pipetting and centrifugation. Total RNAs were extracted using RNAiso Plus reagent (TaKaRa, Japan) according to the manufacturer's instructions. First-strand complementary DNA (cDNA) was generated from mRNA by using PrimerScript™ RT reagent (TaKaRa, Japan). Quantitative real-time PCR was performed using SYBR® Premix ExTaq™ II (TaKaRa, Japan) on a Bio-Rad iQTM5 system (Hercules, USA). Individual gene expression levels were normalized to GAPDH expression. The oligonucleotide primers used in the amplification reaction were 5′-GCTTGGTCCACTTGCTTGAAGA-3′ and 5′-GAGCATTGCCTTTGATTGCTG-3′ for collagen type I-α1 (COLI-α1); 5′-GGAACGGACATTCGGTCCT-3′ and 5′-GGAAGCAGCAACGCTAGAAG-3′ for bone morphogenetic protein 2 (BMP2); 5′-GACGAGTTGGCTGACCACA-3′ and 5′-CAAGGGGAAGAGGAAAGAAGG-3′ for osteocalcin (OCN); and 5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′ for GAPDH.
9
Validation of Differential Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 15 genes were chosen randomly and detected by quantitative real-time PCR (RT-PCR) to confirm the accurate DGE. All primers (S1 Table ) were designed using Primer 5.0 software and synthesized by BGI Company (China). Sample RNAs (1 μg) were reverse-transcribed to cDNA using a reverse-transcription system (Takara, Dalian, China), three individuals’ RNA were used per group at E15, and RT-PCR for each sample was conducted in triplicate. The reaction was run using the IQTM5 System (Bio-Rad, Hercules, CA), and the data were analyzed by the 2-ΔΔCt method using β-actin and GAPDH as internal reference genes. A statistical analysis was performed with GLM processes and t-test using SAS 8.0 software (SAS Institute Inc., Cary, NC).
10
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from different cell and tissue samples was extracted by TRIzol reagent (TaKaRa) in accordance with the manufacturer's protocol. Complementary DNA synthesis was carried out by reverse transcription kits (TaKaRa). Quantitative real-time RT-PCR (qRT-PCR) was performed with a Bio-Rad iQTM5 system (Bio-Rad). For the miR-532-3p expression level, the specific primers of miR-532-3p and reference gene U6 (RiboBio) were used for reverse transcription. The 2−ΔΔCt method was used to analyze qRT-PCR data. Mouse GAPDH was used as a reference gene. The primer sequences of genes detected in this study are listed in Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!