Abi prizm 7300 sequence detection system

A TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was utilized to extract total RNAs from tissues and cells. The first‐strand cDNA synthesis kit (Promega, Madison, WI, USA) was used to perform the reverse transcription and synthesize the cDNA. Next, the SYBR Green Master mix kit (TaKaRa, Otsu, Shiga, Japan) was employed to carry out the qRT‐PCR on ABI Prizm 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The primers were: miR‐15b forward, 5′‐TAGCAGCACATAATGGTTTGTG‐3′; reverse, 5′‐GCGTAGCAGCACATCATGG‐3′; U6 forward, 5′‐CTCGCTTCGGCAGCACA‐3′, reverse, 5′‐AACGCTTCACGAATTTGCGT‐3′; BCL2 forward, 5′‐TGGACAACCATGACCTTGGAC‐3′,reverse, 5′‐GTGCTCAGCTTGGTATGCAGAA‐3′; GAPDH forward, 5′‐CGGAGTCAACGGATTTGGTCGTAT‐3′, reverse, 5′‐AGCCTTCTCCATGGTGGTGAAGAC‐3′. The U6 and GAPDH were utilized as the normalization of miR‐15b and BCL2 and quantified by the 2^‐∆∆Ct method.

Expression levels of the miRNAs were determined using an AB TaqMan Human MicroRNA Array (Applied Biosystems), which included probes for 748 mature human miRNA sequences. Expression of miR-323a-3p was determined by the stem-loop qRT-PCR method. Briefly, complementary DNA (cDNA) was prepared using 2 µg total RNA as template and synthesized using a SuperScript™ First-Strand Synthesis System for RT-PCR Kit (Invitrogen, USA) based on the specific stem-loop RT primers for miR-323a-3p or U6 (RiboBio, China). U6 small nuclear RNA was used as an internal control for miR-323a-3p. For quantification of FMR1 mRNA, total RNA was reverse transcribed into cDNA using a First-Strand cDNA Synthesis Kit (Promega, USA) using FMR1-specific primers. The FMR1 primer sequences were as follows: forward, 5′-CGGCAAATGTGTGCCAAAGA-3′; reverse, 5′-ATGTGCTCGCTTTGAGGTGA-3′. The qRT-PCR was performed on an ABI Prizm 7300 Sequence Detection System (Applied Biosystems) using Light Cycler DNA Master SYBR Green I Mix (Roche, Switzerland) according to the manufacturer’s instructions. All qRT-PCR reactions were performed in triplicate. The expression levels of miR-323a-3p and FMR1 mRNA were quantified using the 2^−ΔΔCt method and normalized to internal control levels.