Mouse Phospho1 sequence was amplified from mouse primary osteoblast cDNA adding a FLAG tag sequence to the 5’ end and cloned into a commercially available pLVX vector (Clonetech Mountain View, CA, USA). An empty vector was used as control. For Lentivirus packaging, a T25 tissue culture flask was seeded with 1.6 × 106 HEK293T cells in 6mls medium (DMEM, 10% FBS, 1% NEAA; Invitrogen), incubated for 24hrs and transfected when 70-90% confluent. The transfection mix was set up in 145μl Opti-Mem (Invitrogen) containing 2μg psPAX2, 1μg of VSV-G and 1.5μg of the desired pLVX plasmid and 17μl of Fugene HD (Roche, East Sussex, UK). The transfection mix was incubated for 15min at room temperature prior to adding to the cells. The transfected cells were incubated at 37°C in 5% CO2 overnight and the medium was collected 24 and 48 hours post transfection to concentrate and titrate the virus. MC3T3-E1 clones were plated at 2 × 105 cells per T25 flask and transduced the next day with the desired lentivirus at 2 virus particles per cell plated. Selection was done by antibiotic selection with puromycin (Invitrogen) at a final concentration 2μg/ml.
Plvx vector
Manufactured by Takara Bio
Sourced in United States, Japan
The PLVX vector is a lentiviral expression vector designed for stable gene expression in mammalian cells. It provides a backbone for the delivery and integration of genes of interest into the host cell genome.
Automatically generated - may contain errors
Lab products found in correlation
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Non essential amino acids (neaa), by Thermo Fisher Scientific (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
Puromycin, by Thermo Fisher Scientific (2 mentions)
Pspax2, by Addgene (2 mentions)
Skov3, by American Type Culture Collection (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Mda mb 231, by American Type Culture Collection (1 mentions)
L glutamine, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Hepg2, by American Type Culture Collection (1 mentions)
Sw620, by American Type Culture Collection (1 mentions)
Ht 29, by American Type Culture Collection (1 mentions)
Lenti x 293t cells, by Takara Bio (1 mentions)
Scc47, by American Type Culture Collection (1 mentions)
Plenticrispr e vector, by Addgene (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Lr clonase, by Thermo Fisher Scientific (1 mentions)
Kod fx neo dna polymerase, by Toyobo (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
22 protocols using plvx vector
1
Lentiviral Overexpression of Mouse Phospho1
2
Lentiviral Overexpression of Mouse Phospho1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse Phospho1 sequence was amplified from mouse primary osteoblast cDNA adding a FLAG tag sequence to the 5′ end and cloned into a commercially available pLVX vector (Clonetech Mountain View, CA, USA). An empty vector was used as control. For Lentivirus packaging, a T25 tissue culture flask was seeded with 1.6×106 HEK293T cells in 6mls medium (DMEM, 10% FBS, 1% NEAA; Invitrogen), incubated for 24 h and transfected when 70–90% confluent. The transfection mix was set up in 145 μl Opti-Mem (Invitrogen) containing 2 μg psPAX2, 1 μg of VSV-G and 1.5 μg of the desired pLVX plasmid and 17 μl of Fugene HD (Roche, East Sussex, UK). The transfection mix was incubated for 15 min at room temperature prior to adding to the cells. The transfected cells were incubated at 37 °C in 5% CO2 overnight and the medium was collected 24 and 48 h post transfection to concentrate and titrate the virus. MC3T3-E1 clones were plated at 2×105 cells per T25 flask and transduced the next day with the desired lentivirus at 2 virus particles per cell plated. Selection was done by antibiotic selection with puromycin (Invitrogen) at a final concentration 2 µg/ml.
3
ITGAV Knockdown in Pancreatic Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Authenticated PDA cell lines PaCa 5061 [9 (link)] and BxPC3 [10 (link)] were used. ITGAV knockdown was achieved using a short hairpin RNA (shRNA) mediated approach: A 65 bp hairpin DNA oligomer containing a 19 bp anti-ITGAV sequence (GGATGGTGTCCACTTCAAA) was inserted into the pLVX vector (Clontech). Potential off-target effects were checked (NCBI BLAST). An shRNA sequence against firefly luciferase was used for the control cell line [11 (link)]. Knockdown and control cells were seeded at three cells per well. Sublines with normal ITGAV and low ITGAV expression were pooled respectively and tested for Mycoplasma. The passage number of used cell lines never exceeded 20.
4
Lentiviral Overexpression and Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate the KLF2 and KLF4 constructs, a plasmid template encoding KLF2 (50786; Addgene) and KLF4 (19764; Addgene) were amplified by PCR to place them downstream of mouse PGK promoter and fuse to IRES-puromycin resistance gene into pLVX vector (Clontech). KLF2- and KLF4-expressing lentiviral particles were prepared by cotransfection of pLVX;PGK-KLF2 or pLVX;PGK-KLF4 with pMDLg/pRRE, pRSV-Rev, and pMD2.G in HEK293T cells. Oligos for ShKRIT1 (clone TRCN0000072879, target sequence 5′-CGGGTAGATAAAGTGGTAATA-3′) is based on the public TRC (RNAi Consortium; Broad Institute) library and cloned into pLKO.1 using EcoRI and Age1 restriction sites. For KLF2, KLF4, or shRNA delivery, HUVECs were grown to 80% confluence on gelatin-coated six-well plates and transduced with lentiviral particles. 72 h after infection, HUVECs were prepared for RNA or protein analysis (described above).
5
Murine ADAR1 Mutant Generation
6
Characterization of Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human melanoma (624Mel), lung cancer (PG, A549), liver cancer (Huh7, HepG2), breast cancer (MDA-MB-231), ovarian cancer (SKOV3), cervical cancer (HeLa), squamous carcinoma (SCC-47), colon cancer (HT-29, SW620), immortal epithelial (HLB100) cell lines were purchased from ATCC. Lenti-X 293T cells were purchased from TaKara. MDA-MB-231-H3KO cell line was generated from MDA-MB-231 cells by genetically knocking out B7-H3 gene using pLentiCRISPR-E vector (Addgene, 78852). PG cell line were transduced with lentiviral vector encoding the luciferase reporter gene luc2P (Photinus pyralis) or the human 4Ig-B7-H3 cDNA (pLVX vector, Clontech) to generate PG-luc cell line and PG-hB7-H3 cell line, respectively. All cells were maintained in RPMI-1640 supplemented with 10% fetal bovine serum and 2 mmol/L L-glutamine (Invitrogen).
7
Engineered SMARCA4 and SMARCA2 Expression Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For expression of SMARCA4res and SMARCA2ect the following constructs were generated by gene synthesis (GenScript, China) based on the SMARCA4 cDNA sequence NCBI NM_ 001128844.1 and SMARCA2 cDNA sequence NCBI NM_003070.5 and cloning into the parental pLVX vector (Clontech, Mountain View, CA, US): pLVX-empty-IRES-Hygro; pLVX-SMARCA4-wt-IRES-Hygro; pLVX-SMARCA4-ATP-binding deficient (K785A)-IRES-Hygro; pLVX-SMARCA4-BD-dead(N1540A)-IRES-Hygro; pLVX-SMARCA2-wt-IRES-Hygro; pLVX-SMARCA2-ATP-binding-deficient(K755A)-IRES-Hygro; pLVX-SMARCA2-BD-dead(N1482A)-IRES-Hygro; pLVX-SMARCA4res-BDBRD9-IRES-Hygro. ATP-binding deficient and BD-dead sites were selected similar to known inactivating mutations in SMARCA2/441 (link),42 (link). The sequence of SMARCA4res-BDBRD9 is shown in Supplementary Table 3 . All constructs were codon optimized to render the transgenes resistant towards siRNAs and sgRNAs. For SMARCA4, DEXDc (DEAD-like helicases superfamily) and HELIC (helicaseC) domains were annotated according to UniProt entry P51532, bromodomain (BD) was annotated according to NCBI entry 6597 (cd05516). For SMARCA2, domains were annotated according to UniProt entry P51531, bromodomain (BD) was annotated according to NCBI entry 6595 (cd05516).
8
Overexpression of Mouse and Human Genes in Fibroblasts and iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For overexpression in mouse fibroblasts, pMXs-Gateway vector (Addgene #18656) was used. All coding sequences of selected 38 mouse genes were amplified by RT-PCR with KOD FX Neo DNA polymerase (Toyobo) and single strand cDNA synthesized by SuperScript 3 Reverse Transcriptase (Invitrogen) from mouse Pax3-GFP adult MuSCs. These cDNAs were subsequently subcloned into the pENTR1 and pMXs vectors. For human iPSCs, piggyBac-Gateway vector was used (Addgene #20960). All human cDNA constructs involving coding sequences were obtained from the human proteome expression resource HuPEX library (Goshima et al., 2008 (link)). Human cDNAs were transferred into the pLVX vector (Clontech) to overexpress in human fibroblasts and the pPiggyBac-Gateway vector with the LR clonase (Invitrogen) to overexpress in human iPSCs.
9
Generation of Stable GPR39-Expressing Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stable HEK293 cell lines expressing the mouse GPR39 gene were generated by the lentivirus system. Briefly, mouse GPR39 fused with mCherry by a P2A linker was cloned into the pLVX vector (Clontech). pLVX-mGPR39-P2A-mCherry plasmid was cotransfected with packaging plasmids pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260) into HEK293T cells using Lipofectamine 3000 (Invitrogen). After 24 hours of transfection, the cells were treated with puromycin (2 μg/ml) for 2 days, before the selection of GPR39-expressing single clones by mCherry fluorescence protein using flow sorting. Stable human GPR39-expressing cell lines were obtained similarly.
10
Lentiviral Knockdown of SIRT6 in Rat Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length of rat SIRT6 were cloned into pLVX vector (Clontech Laboratories, Mountain View, CA, USA). A pair of 59-nt long oligos (5’-ATTCGTGTAAGACGCAGTACGTGTTCAAGAGACACGTACTGCGTCTTACACTTTTTTG-3’ and 5’-AATTCAAAAAAGTGTAAGACGCAGTACGTGTCTCTTGAACACGTACTGCGTCT TACACG-3’), encoding a 19-nt long rat sh-SIRT6 was obtained from GenePharma (Shanghai, China). A scramble shRNA was used as negative control (sh-NC). Lentivirus production was performed in HEK293T cells using Xfect transfection reagent (Clontech Laboratories). HAPI cells or BMVECs were infected with lentivirus for 48 h.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!