The untagged human LMNA (lamin C) (NM_005572) clone (#SC321549) and the tagged human LMNA (lamin A) (NM_170707) Clone (#RC204970) were purchased from OriGene Technologies (Jiangsu, China). PCR products containing the LMNA/C cDNA or different mutations were purified, sequenced (Rui Bo Xing Ke Company, Beijing, China) and then cloned into the pCMV6-AC vector (PS100020, OriGene) or pCMV6-AC-GFP vector (PS100010, OriGene) to construct plasmids to express lamin A, lamin C and the different mutants. Two restriction endonucleases (BamHI and NotI) were used in the cloning process. The plasmids were extracted with the Endotoxin-Free Plasmid Medium Extraction Kit (CW2105s, CW Biotech, Jiangsu, China) and transfected into cells with Lipofectamine 3000 (Invitrogen, 2105082, Carlsbad, USA). Western blot analysis was used to verify expression. The primer sequences are listed in Supplemental Table S1 .
Pcmv6 ac vector
Manufactured by OriGene
Sourced in China
The PCMV6-AC vector is a plasmid designed for the expression of genes in mammalian cell lines. It contains a cytomegalovirus (CMV) promoter for high-level expression of the target gene and an ampicillin resistance gene for selection in bacteria.
Automatically generated - may contain errors
Lab products found in correlation
9 protocols using pcmv6 ac vector
1
Cloning and Expressing LMNA/C Variants
2
Generating Isoform-Specific ADARB1 Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ORF for the human ADARB1 short isoform (without the Alu exon) in the pCMV6-AC vector was purchased from OriGene, Inc. (catalog no. SC321955; reference transcript NM_001112). Mutageneses using the QuikChange method (Stratagene) were carried out to convert the ORF to encode the ADARB1 reference protein sequence NP_001103. Six nucleotides in pCMV6-AC encoding two additional amino acids at the C-terminus were removed. A minor allele SNP (rs199697177) ‘C’ (allele frequency <1 %) was mutated back to the major allele ‘T’ in the ADARB1 ORF. Then the Alu exon was inserted using the same mutagenesis method. Final pCMV6-ADARB1-short (without the Alu exon) and pCMV6-ADARB1-long (with the Alu exon) constructs were confirmed by sequencing.
3
Genetic Manipulation of PAX5 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For PAX5 knockout and knockdown, 3 × 106 cells were used per electroporation. Cells were washed, pelleted, and resuspended in a buffer from the Lonza SF kit V4XC-2024 (Lonza, Basel, Switzerland). The resuspended cells were combined with the ribonucleoprotein complex or small interering (siRNA). The ribonucleoprotein complex was generated by incubating TrueCut caspase 9 (Cas9) Protein V2 (5 μM final, Invitrogen, Waltham, MA), with PAX5 single guide RNA (10 μM final; target sequence ATCCTCTGGCGGACTACATC; Thermo Fisher) in kit buffer. Cells and the ribonucleoprotein complex were electroporated in 100 μL cuvettes using the preset program DN-100. For knockdown, 1 nmol PAX5 Silencer siRNA #s10064 or siRNA negative control #AM4611 (Invitrogen) was electroporated using the preset program DS-104.
For PAX5 overexpression, the PAX5 plasmid #SC304450 or the pCMV6-AC vector (OriGene, Rockville, MD) was transformed into DH5alpha Escherichia coli cells (OriGene), inoculated overnight, and streaked on lysogeny broth/ampicillin agar plates. Isolated clones were inoculated, followed by plasmid isolation using the Plasmid Midi Kit (Qiagen). Electroporation of 2×106 cells resuspended in buffer R and 25 μg plasmid DNA was performed with 3 pulses at 1400V for 10 milliseconds using a Neon Tip system (Thermo Fisher).
For PAX5 overexpression, the PAX5 plasmid #SC304450 or the pCMV6-AC vector (OriGene, Rockville, MD) was transformed into DH5alpha Escherichia coli cells (OriGene), inoculated overnight, and streaked on lysogeny broth/ampicillin agar plates. Isolated clones were inoculated, followed by plasmid isolation using the Plasmid Midi Kit (Qiagen). Electroporation of 2×106 cells resuspended in buffer R and 25 μg plasmid DNA was performed with 3 pulses at 1400V for 10 milliseconds using a Neon Tip system (Thermo Fisher).
4
In Utero Electroporation of Nkx2.1 cDNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCMV6-AC vector containing the human Nkx2.1 cDNA full length (transcript variant 1) was purchased from Origene (NM_001079668). Mouse Nkx2.1 cDNA full length containing vector was obtained from Stewart Anderson's lab (University of Pennsylvania School of Medicine). Briefly, 1 μl of plasmid mixtures of human-Nkx2.1 ormouse-Nkx2.1 cDNA and pCAGG-EGFP(3:1 ratio, 2 μg/μl total mixture concentration) was injected into the cerebral ventricles followed by IUE as described earlier (Dominguez et al., 2013 (link); Gal et al., 2006 (link)).
5
Necdin overexpression in ovarian cancer cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human necdin cDNA in a pCMV6-AC vector (OriGene, Rockville, MD) was transfected into SKOv3ip and HEY ovarian cancer cells using MegaTran 1.0 transfection reagent (OriGene). Twenty four hours post transfection, cells were reseeded in 6-well plates and selected with G418 media (1.2 mg/ml for SKOv3ip and 0.7 mg/ml for HEY). The cells were allowed to grow for 12 days until visible colonies were formed and then stained with 0.5% methylene blue. Colonies containing at least 50 cells were scored.
6
Generation of NGLY1-deficient Drosophila Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NGLY1 cDNA in pCMV6-AC vector (clone SC320763, OriGene) was used as template for site-directed mutagenesis to introduce the c.1205_1207del clinical mutation (Enns et al., 2014 (link)), which results in the generation of NGLY1-ΔR402. Wild-type and ΔR402 cDNAs were transferred from pCMV6-AC to pUAST-attB vector by EcoRI-XhoI double digestion and ligation, verified by sequencing, and integrated into the VK31 docking site by ΦC31-mediated transgenesis (Bischof et al., 2007 (link); Venken et al., 2006 (link)).
7
Generation of NGLY1 Mutant Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NGLY1 cDNA in pCMV6-AC vector (clone SC320763, OriGene) was used as a template for site-directed mutagenesis to introduce the c.121-122AA > CC and c.236-241GCCTTT > GCCGCT mutations, which result in the generation of NGLY1N41P and NGLY1G79A/F80A, respectively. The following primers were used (5’ to 3’): hNG1-N41P-for CTCACCTATGCTGACCCCATCCTCAGAAACCC hNG1-N41P-rev GGGTTTCTGAGGATGGGGTCAGCATAGGTGAG hNG1-G79F80-for GTTTATTTGAAATGGCCGCTGAAGAGGGAGAAAC hNG1-G79F80-rev GTTTCTCCCTCTTCAGCGGCCATTTCAAATAAAC cDNAs of mutant versions of NGLY1 were transferred from pCMV6-AC to pUAST-attB vector by EcoRI-XhoI double digestion and ligation, exactly as performed before for wild-type NGLY1 construct (Galeone et al., 2017 (link)), verified by sequencing, and integrated into the same docking site (VK31) by ΦC31-mediated transgenesis (Venken et al., 2006 (link); Bischof et al., 2007 (link)). Embryo injections were performed by GenetiVision (Houston, USA).
8
Stable Transfection of HEK-293 Cells with FPR1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK-293 cells were maintained in DMEM supplemented with 10% FBS, 2 mM glutamine, and antibiotics. HEK-293 were stably transfected with the pCMV6-AC vector containing the human FPR1 gene (NM_002029; OriGene, Rockville, MD) using X-treme GENE Hp DNA transfection reagent (Roche, Mannheim, Germany). FPR1-expressed HEK-293 were cultured in the medium containing G418 (2 mg/ml) for further studies48 (link).
9
In Utero Electroporation of Nkx2.1 cDNA
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!